ID: 1057997293

View in Genome Browser
Species Human (GRCh38)
Location 9:99829563-99829585
Sequence CAGAGAAGGGAGATGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057997287_1057997293 -7 Left 1057997287 9:99829547-99829569 CCTCAGGACACACCTTCAGAGAA 0: 1
1: 0
2: 2
3: 23
4: 289
Right 1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057997293 Original CRISPR CAGAGAAGGGAGATGGAGGC AGG Intronic
No off target data available for this crispr