ID: 1057997457

View in Genome Browser
Species Human (GRCh38)
Location 9:99831138-99831160
Sequence CTTAAACACAAATGTAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057997451_1057997457 -2 Left 1057997451 9:99831117-99831139 CCATAATGATCTCTCCCTGTCCT 0: 1
1: 0
2: 0
3: 37
4: 295
Right 1057997457 9:99831138-99831160 CTTAAACACAAATGTAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057997457 Original CRISPR CTTAAACACAAATGTAGGGA AGG Intronic
No off target data available for this crispr