ID: 1057999741

View in Genome Browser
Species Human (GRCh38)
Location 9:99852837-99852859
Sequence CTGGAAAGACAGATGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 485}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057999741_1057999746 1 Left 1057999741 9:99852837-99852859 CCCTCCACCATCTGTCTTTCCAG 0: 1
1: 0
2: 3
3: 50
4: 485
Right 1057999746 9:99852861-99852883 GCTCCACTGCTCACTGTAAATGG No data
1057999741_1057999748 9 Left 1057999741 9:99852837-99852859 CCCTCCACCATCTGTCTTTCCAG 0: 1
1: 0
2: 3
3: 50
4: 485
Right 1057999748 9:99852869-99852891 GCTCACTGTAAATGGTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057999741 Original CRISPR CTGGAAAGACAGATGGTGGA GGG (reversed) Intronic
900561500 1:3309277-3309299 CTGGGAACACTAATGGTGGAGGG + Intronic
900573469 1:3371461-3371483 ATGGATGGATAGATGGTGGATGG - Intronic
900573486 1:3371516-3371538 ATGGATGGATAGATGGTGGATGG - Intronic
901006594 1:6174672-6174694 GTGGAAGGATGGATGGTGGATGG + Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903850427 1:26302521-26302543 CTGCAAACACAGATGGTCTACGG - Intronic
903909712 1:26714163-26714185 CTGAAAAGACAGCTGGTGACTGG + Intronic
904686455 1:32264313-32264335 CTGGAAAGTCTAAGGGTGGAGGG - Intronic
905386759 1:37609937-37609959 CTTGAAAGACAGATTAGGGAGGG - Intergenic
905885505 1:41489686-41489708 ATGGATAGAAAGAAGGTGGATGG - Intergenic
905885551 1:41489884-41489906 ATGGATAGAAAGAAGGTGGATGG - Intergenic
906826728 1:48989517-48989539 CTGGAAGGATAGTTGGTGGGTGG - Intronic
907306701 1:53517331-53517353 CTGGACAGACAGGTGGTGCTAGG - Intronic
907313393 1:53552635-53552657 CTGGGAGGATGGATGGTGGAGGG - Intronic
910322767 1:85967496-85967518 TTAGAAAGAAAGATGGTGGTTGG + Intronic
910536184 1:88300489-88300511 CAGGAGAGAGAGATGCTGGAGGG - Intergenic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
912152522 1:106878079-106878101 CTGGACAAACAGTTAGTGGAGGG - Intergenic
912155946 1:106920072-106920094 GTGGAAAAACAGGTGGTGGAAGG + Intergenic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912748504 1:112266101-112266123 CCAGACAGTCAGATGGTGGAAGG + Intergenic
912919172 1:113849019-113849041 CTGGAAAAAGAGATAGTGGTTGG + Intronic
913053695 1:115138728-115138750 CTGGACAGACAAGTGGGGGATGG - Intergenic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
914351393 1:146843115-146843137 ATGGATAGATAGATGATGGATGG + Intergenic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
915357827 1:155266896-155266918 CTGAGAAGAGAGATGGGGGAAGG + Intronic
917127086 1:171696572-171696594 CTGGAAAAACAGAGGGTAAAGGG + Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918626291 1:186659355-186659377 GTGGAAAGAAAGATGATTGATGG - Intergenic
919097150 1:193051250-193051272 CTGGTCAGAAAGATGGGGGAAGG + Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920760568 1:208780138-208780160 CTGGAAAGACAGGTTTGGGAAGG - Intergenic
920841891 1:209562144-209562166 CTGGAAACACAGGGGGTGCAGGG + Intergenic
921638980 1:217529034-217529056 TTGGACAGACAGATGATGCATGG + Intronic
922469631 1:225867973-225867995 CTGGAAGGACAGGTAGTGGATGG + Exonic
922792933 1:228320339-228320361 ATGGATGGATAGATGGTGGATGG - Intronic
923612684 1:235509443-235509465 CTGGAAAGAAAGATTGGGGTGGG - Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1063856256 10:10257470-10257492 CTGGAAACATAGAAGTTGGAAGG - Intergenic
1065045806 10:21746886-21746908 CGGGAAAGGCAGATGGGAGAAGG + Intergenic
1065860674 10:29870310-29870332 ATGGTTAGACAGATGGTGGTTGG - Intergenic
1066418081 10:35239354-35239376 GTGGCAAGACAGATTATGGATGG + Intergenic
1066623712 10:37384600-37384622 ATGAAAAGACCGATGGTGAAAGG + Intergenic
1067420445 10:46140850-46140872 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1067425576 10:46208683-46208705 CTGGAAAGACAGAATGGGGCTGG - Intergenic
1067505789 10:46847331-46847353 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1068673701 10:59748823-59748845 CTGGAATCAAAGATGTTGGAGGG - Intergenic
1070153385 10:73818834-73818856 CTGCAAGGATAGATGGTGGGAGG + Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070921031 10:80186515-80186537 AAGGCAAGACTGATGGTGGAGGG + Intronic
1070965146 10:80525696-80525718 CTGGATGGACAAGTGGTGGAAGG - Exonic
1073148025 10:101293023-101293045 CTGGAGAGACACAGGGTGGGTGG - Intergenic
1073321085 10:102616652-102616674 CTGGAAATACACCTGGGGGAGGG - Intronic
1073428409 10:103470541-103470563 GTGGAAAGAAAGATGGAGGGAGG - Intergenic
1074186899 10:111105610-111105632 GTGGGAATACAGATGATGGAGGG - Intergenic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074442746 10:113493168-113493190 GTGGAAAGACAGAGTGTGAAGGG - Intergenic
1074828036 10:117228631-117228653 AGGGAAAGACAGAGGGAGGAAGG - Intergenic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1075222890 10:120600267-120600289 CTGGAAAGTCACAAGGGGGATGG + Intergenic
1075487027 10:122830768-122830790 CTGGATAGAGAGATGGCTGAAGG + Intergenic
1076229940 10:128811780-128811802 CTGGAAAGAAAGATGGTTTTCGG + Intergenic
1076444972 10:130508041-130508063 CAGAAAAGACAGATGGATGAGGG - Intergenic
1076547185 10:131253228-131253250 CAGGAATGACAGCTGGTGGGTGG + Intronic
1076569358 10:131422234-131422256 CTGGAAAGACAAAGTGTAGAAGG - Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1079119792 11:17673682-17673704 TTTGAAAGACAGATTGGGGAAGG - Intergenic
1079321781 11:19457469-19457491 CTGGGAAGAGGGATGGAGGAGGG + Intronic
1081542325 11:44044899-44044921 ATGGAAAGGTAGATGGTGGGAGG + Intergenic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1082988063 11:59184946-59184968 CTGCAATGACAGAAGGTCGATGG - Intronic
1083224744 11:61277703-61277725 ATGAAAAGACAGAGGGTGGGAGG - Intronic
1084684656 11:70686492-70686514 ATGGATAGACAGATGATGGATGG - Intronic
1084729540 11:71064581-71064603 CTGGAAGGAAAGAGGCTGGATGG + Intronic
1085031514 11:73273758-73273780 ATGGAAAAACAGGTGGTGGATGG - Intronic
1086163471 11:83749574-83749596 CTGGAAATACAGCTGCTGGGTGG - Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087237792 11:95739377-95739399 ATTAAAAGACAGATGGTGAAGGG - Intergenic
1087392867 11:97560753-97560775 GTGGAAAGACACAGGGTGGAGGG - Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1089603114 11:119627042-119627064 CTGGTATGACGGATGGGGGAGGG + Intronic
1089834710 11:121359841-121359863 CTGGTAAGACAGATCCTGAAAGG + Intergenic
1090827868 11:130400570-130400592 CAGGAAAGATGGATGGGGGAAGG + Intergenic
1091219522 11:133921703-133921725 CTGGAAAGACGGATGATGGGGGG - Intronic
1091370498 11:135053687-135053709 CCAGAAACACAAATGGTGGAAGG - Intergenic
1092090141 12:5797588-5797610 CTGGAAAGAGAAGTGATGGAAGG - Intronic
1093236256 12:16611133-16611155 AGGGAAAGAGAGATGGGGGAGGG + Intergenic
1093423947 12:19006733-19006755 CTTGCAAGACAGATGTTTGAGGG - Intergenic
1093457866 12:19382370-19382392 CTGGCAACAGAGTTGGTGGAGGG - Intergenic
1094174786 12:27530287-27530309 CTGGGAAGTGAGAGGGTGGAAGG + Intronic
1095174136 12:39071264-39071286 CTGAAAAGACAGATCCAGGATGG - Intergenic
1095773956 12:45991790-45991812 CTGGAAGGTCAGCTGGTAGATGG - Intronic
1096809519 12:54160608-54160630 GTGGAAGGAGAGGTGGTGGATGG - Intergenic
1097459810 12:59847180-59847202 CTTGAAAAAAAGATGGTGGGGGG - Intergenic
1097954654 12:65471070-65471092 CTGGAAACAGAGATGGTAGTTGG - Intronic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1100027704 12:90150199-90150221 CTGGAACCTCACATGGTGGAAGG - Intergenic
1100040632 12:90313137-90313159 CTTGAAAGACAGTTGGTGGTTGG + Intergenic
1100325222 12:93533817-93533839 CTGCAAAGGGGGATGGTGGATGG + Intergenic
1100654446 12:96626008-96626030 CTGGAAAGACAGAATCTTGATGG + Intronic
1102741717 12:115213522-115213544 CTGCAAAGAAAAATAGTGGAAGG - Intergenic
1102785955 12:115604986-115605008 ATGGACAGATAGATGATGGATGG + Intergenic
1103040501 12:117691331-117691353 CTGCAAAGAAAGATGGTGCCAGG + Intronic
1103587102 12:121963942-121963964 CTGGAAAGAAGGATGGAGGCAGG + Intronic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1106029618 13:25988297-25988319 CTGCACAGGCAGATGGTGAAAGG + Intronic
1106124474 13:26889087-26889109 CTGGGAAGACAGAGGTTGCAGGG + Intergenic
1106442063 13:29784226-29784248 CGGGAAAGAAAGAGGGAGGATGG + Intronic
1107349581 13:39500123-39500145 CTGGAAAGTGAGATGATGAAGGG - Intronic
1107430758 13:40338248-40338270 CTGGAAGGACAAATGCTTGATGG + Intergenic
1107712741 13:43166748-43166770 CTGAAAATACAGAGGATGGATGG + Intergenic
1108119160 13:47164569-47164591 CTGGAAACACATATGTTGGTTGG - Intergenic
1108224806 13:48277554-48277576 CTGGAAAGAAAGAAGGAGGGAGG + Intergenic
1108238285 13:48432241-48432263 CTGGAAATACAGATTGGAGAAGG - Intronic
1108713394 13:53056114-53056136 CTGGAAAGGCTGAAGGTGCAGGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109994359 13:70103930-70103952 CTGTAAAGACAGTTTATGGATGG + Intronic
1110019420 13:70451247-70451269 CAGGAAAGACAGTTTGTGCAGGG - Intergenic
1110329359 13:74253108-74253130 CTAGAAATACAGATGATGAATGG - Intergenic
1111764234 13:92507209-92507231 CTGTGAAGACAAACGGTGGATGG - Intronic
1112195032 13:97217517-97217539 CTGGATAGAAAGATGTTAGATGG + Intergenic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1113188572 13:107717985-107718007 CTGGAACAACAGCAGGTGGAGGG - Intronic
1113230222 13:108205695-108205717 CTGGAAAGTCATATGGTGTAGGG - Intergenic
1113432447 13:110262318-110262340 CTGGGAAGGCTGATGGTGGAGGG - Intronic
1115913802 14:38286989-38287011 ATGGAAAGAAACATGGTAGAAGG - Intergenic
1116837383 14:49783409-49783431 CTGGAAAAACAAAGTGTGGAGGG + Exonic
1117267166 14:54101659-54101681 TTGGATAGATAGATGATGGATGG - Intergenic
1118700356 14:68426904-68426926 CTGGAAAGTCAGCCTGTGGATGG - Intronic
1118816673 14:69318970-69318992 CAGGAAAGACGGAAGATGGAAGG - Intronic
1119177967 14:72583368-72583390 CTGGATAGATAGATGATAGACGG + Intergenic
1119580621 14:75776358-75776380 GAGGAAAGACAGATCTTGGAAGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119877748 14:78074994-78075016 AGGGAAAGAGAGATGGGGGAAGG + Intergenic
1120991311 14:90379919-90379941 CTGAAAAGGCAGATTATGGAGGG + Intergenic
1121095948 14:91218094-91218116 CAGGGAAGAGAGATGGGGGAGGG + Intronic
1121259617 14:92556525-92556547 ATGGGAAGATAGATGATGGATGG + Intronic
1122151522 14:99728552-99728574 CTGGAAATGGAGAGGGTGGAGGG - Intergenic
1122355091 14:101118162-101118184 CTGGAAGGAGAGATGGAGGGAGG - Intergenic
1122600704 14:102920301-102920323 GTGGATGGATAGATGGTGGATGG - Intergenic
1122958447 14:105083551-105083573 GTGGATAGAGAGATGGTGGATGG - Intergenic
1123133602 14:106007676-106007698 CTGGAAGGACAGATCTTGGAGGG + Intergenic
1202927185 14_KI270724v1_random:37379-37401 TTTGAAAGGCAGATGCTGGAGGG - Intergenic
1123583626 15:21738122-21738144 CTGGAAGGACAGATCTTGGAGGG + Intergenic
1123620276 15:22180725-22180747 CTGGAAGGACAGATCTTGGAGGG + Intergenic
1125029553 15:35062430-35062452 CTAGAAAGACAGATGTTATATGG - Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125545631 15:40502167-40502189 CTGGAAAGACAGTTCCTGGATGG + Intergenic
1127251218 15:57240442-57240464 CTGATAACACTGATGGTGGATGG - Intronic
1128164987 15:65456132-65456154 CTTGAAAGAGAGTTGGGGGAAGG - Intronic
1128208026 15:65869943-65869965 CCGAAAAGAGAGATGGTGGGAGG - Intronic
1128305813 15:66598286-66598308 CTTGAAAGCCTGAGGGTGGAAGG + Intronic
1128308479 15:66615546-66615568 ATGGACAGGCAGATGATGGAAGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128518919 15:68362553-68362575 ATGGATAGACAGATGATAGATGG + Intronic
1128651625 15:69419388-69419410 GTGGAGAGACAGATGGGAGACGG - Intronic
1128775075 15:70314016-70314038 CTGGTAAGGCTGATAGTGGAAGG - Intergenic
1129025239 15:72565798-72565820 CTGAAAAGAAAGATGGGGAATGG - Intronic
1130101354 15:80896648-80896670 CTGGAATCACAGATTGTTGAAGG + Intronic
1130203576 15:81855127-81855149 ATGGAAAGACTGATGGCAGAAGG - Intergenic
1131551588 15:93361998-93362020 CTGGAAATAAACATGGGGGAGGG - Intergenic
1131826596 15:96326556-96326578 GTGGTAGGAGAGATGGTGGAGGG + Intronic
1131830742 15:96353087-96353109 CTGGACAGGGAGATGGTGGTTGG + Intergenic
1132712021 16:1273085-1273107 ATGGGTAGACAGATGGTAGATGG + Intergenic
1133197042 16:4178396-4178418 ATGGAATGACAGACGATGGATGG + Intergenic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1134488439 16:14677764-14677786 CTGGATAGATGGATGGTGGGTGG + Intronic
1134632283 16:15765457-15765479 ATGGATGGACAGATGATGGATGG + Intronic
1135400155 16:22161381-22161403 GTGGAAGGATAGATGATGGAAGG + Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136071410 16:27789795-27789817 ATGGATGGACAGATGATGGATGG + Exonic
1136178517 16:28535111-28535133 CTGGGAAGTGAGATGGGGGAGGG - Intronic
1136580793 16:31149732-31149754 CTGGAAAGACAGAGGTAGGCAGG + Intronic
1137387607 16:48055908-48055930 CTGGGAAGTGAGATCGTGGAGGG - Intergenic
1137687866 16:50399417-50399439 CTGTAATGACAGATGGTGGAGGG + Intergenic
1137760824 16:50938998-50939020 CTGGAAGGAGAGGTGGTGGGCGG + Intergenic
1138250470 16:55498208-55498230 GTGGACAGACAGATGATGGGAGG + Intronic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138686399 16:58729828-58729850 CTTAAAAGACAGAGGCTGGAGGG - Intronic
1140310613 16:73844810-73844832 ATGGGTAGACAGATGGTAGACGG + Intergenic
1140783930 16:78321964-78321986 CTGCAGAGACAGGTTGTGGATGG + Intronic
1140817652 16:78635788-78635810 TTGGAAAAACAGCTAGTGGAAGG + Intronic
1141110140 16:81265456-81265478 GTGGGTAGATAGATGGTGGATGG - Intronic
1141110255 16:81265956-81265978 GTGGATGGATAGATGGTGGATGG - Intronic
1141151861 16:81569998-81570020 TTTGACAGACAGATGCTGGAGGG - Intronic
1141441880 16:84034419-84034441 GAGGTAAGACAGATGGGGGAGGG + Intronic
1141898342 16:86972839-86972861 AAGCAAAGACAGATGGTAGATGG + Intergenic
1142065232 16:88058601-88058623 ATGGAAAGAACGATGGTGGTGGG - Intronic
1142124216 16:88402151-88402173 ATGGATGGAGAGATGGTGGATGG + Intergenic
1142244718 16:88964783-88964805 CTGGATGGATAGATGGTGGATGG - Intronic
1142809525 17:2388763-2388785 CGGGAAAGACTGAGTGTGGAGGG - Intronic
1143718407 17:8792834-8792856 CTGGAAAGACAGATGGGACCAGG - Intergenic
1143914443 17:10278658-10278680 CTGGAAATGGAGTTGGTGGACGG + Intergenic
1144069360 17:11653926-11653948 ATGGAAATACAGCTGATGGATGG - Intronic
1144300862 17:13922207-13922229 ATGGAAAGCCAGAAGGGGGATGG - Intergenic
1145052814 17:19676912-19676934 TGGGGCAGACAGATGGTGGATGG + Exonic
1146939192 17:36832292-36832314 ATGGACAGATGGATGGTGGATGG - Intergenic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148001450 17:44389887-44389909 CTGTACAGCCAGATGGGGGAAGG - Intergenic
1148148845 17:45384255-45384277 TGGGAAAGACAGATGGGGGAAGG + Intergenic
1148774951 17:50090033-50090055 CTGGACAGACAGATGTTGGGAGG + Intronic
1148987129 17:51632744-51632766 GTGGAAAGAAAGATGGAGGAAGG - Intronic
1150135384 17:62692517-62692539 CTGGACAGGCAGCTGGTGGGGGG - Exonic
1150634543 17:66903803-66903825 GTGGATAGATGGATGGTGGAGGG + Intergenic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1151519582 17:74618618-74618640 GAGGAAAGGCAGATGGTGGGAGG - Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152296203 17:79468378-79468400 ATGCATAGACAGATGATGGATGG + Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1155131565 18:22939899-22939921 CAGGCAAGGAAGATGGTGGAAGG + Intronic
1156319091 18:36001362-36001384 GTGGAAAGACTGATTATGGAGGG - Intronic
1157401860 18:47395442-47395464 CTGGGAACACAGATGATGGCTGG - Intergenic
1158207646 18:55011277-55011299 CAGGAAATACACATGGTGGAAGG - Intergenic
1160239427 18:77112559-77112581 CTGGAAACAGAGAAGGGGGAGGG - Intronic
1160692724 19:467192-467214 GTGGAAAGATGGTTGGTGGAGGG + Intronic
1160854351 19:1209664-1209686 ATGGGAAGACAGACGCTGGAGGG + Intronic
1161105279 19:2440752-2440774 ATGGATAGATAGATGATGGATGG - Intronic
1161454896 19:4365210-4365232 GTGGAAGGACAGATGCTGGGGGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161494235 19:4578991-4579013 CCGGAAAGGGAGATGCTGGAGGG - Intergenic
1162547323 19:11338755-11338777 CTGGAAAGACCAAGGGTGGGCGG - Intronic
1163609880 19:18295299-18295321 GTGGATGGGCAGATGGTGGATGG - Intergenic
1164393800 19:27846798-27846820 CTGGACAAACAGATACTGGAGGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165102069 19:33444802-33444824 GTGGAGAGAGACATGGTGGATGG - Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1166576250 19:43841000-43841022 CTGGAAAGACAGATTGTCATTGG - Intronic
1166935564 19:46330444-46330466 AAGGAAGGATAGATGGTGGATGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167233916 19:48302493-48302515 TTGGAGGGACAGATGATGGATGG + Intronic
1168298729 19:55390881-55390903 TTGGAGAGAGAGATGTTGGATGG + Intronic
925352357 2:3210342-3210364 CTGGAAAAACAGATGTGGGTGGG - Intronic
925470461 2:4155760-4155782 ATGGATAAACAGATGATGGATGG - Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
927107635 2:19841620-19841642 CTGGGGAGACAGATAGTGTAAGG + Intergenic
927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG + Intergenic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
928111651 2:28515322-28515344 CTGCACAGACAGATGGTAGCTGG - Intronic
930213547 2:48669107-48669129 CTGGAAATACAGAGTGGGGATGG - Intronic
932601902 2:73133412-73133434 AGGGAAGGAGAGATGGTGGAGGG + Intronic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
935800084 2:106687058-106687080 CAGGCAAGAGAGATTGTGGAGGG + Intergenic
936155046 2:110041871-110041893 CAGTAAAGACAGAGGGTTGACGG - Intergenic
936189636 2:110329543-110329565 CAGTAAAGACAGAGGGTTGACGG + Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936378852 2:111966722-111966744 CTGGAAAGGCAGATGCTTTAGGG + Intronic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
937471569 2:122178293-122178315 CTGAAAAGAAAGATGGTGAAAGG - Intergenic
937471576 2:122178350-122178372 CTGAAAAGAAAGATGGTGAAGGG - Intergenic
937970743 2:127546885-127546907 GTGGATAGATGGATGGTGGATGG - Intronic
940007938 2:149026166-149026188 TGGGAAAGGCAGAGGGTGGAGGG + Exonic
940639401 2:156331587-156331609 CCAGAAAGGCAGATTGTGGAAGG - Intronic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
942892338 2:181006394-181006416 CTGGAACGGCAAAAGGTGGAAGG - Intronic
943095500 2:183423445-183423467 CTGGAAAGCAAGCTGGTTGAAGG - Intergenic
943195760 2:184746692-184746714 CTGGAAAGGGTGATGGGGGAGGG - Intronic
945012070 2:205475621-205475643 CTGCAAATACATATGGTGGCAGG + Intronic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946822752 2:223647263-223647285 CAGGAAAGACAGAGGCTGCAGGG - Intergenic
947110575 2:226714909-226714931 CTGGAATGAATAATGGTGGAAGG - Intergenic
947170679 2:227308083-227308105 CTGGAATGTAAAATGGTGGAAGG + Intronic
947219290 2:227777735-227777757 AAGGAAAGAAAGAAGGTGGAAGG - Intergenic
947706698 2:232282099-232282121 CTGGAAAGACAGAGAGTAGGAGG - Intronic
947779160 2:232741962-232741984 CTGGAAAGAGAGTCGGAGGAAGG - Intronic
947983728 2:234431049-234431071 TTGGCAAGACAGATGATGGGAGG + Intergenic
948361588 2:237424872-237424894 CAGGAAAGACAGAGGGTTGCTGG + Intronic
948988824 2:241541637-241541659 CTGGAGAGCGAGATGCTGGACGG - Intergenic
949055387 2:241925370-241925392 CTCGGAAGACCGATGTTGGAGGG + Intergenic
949065948 2:241990392-241990414 GTGGATAGATGGATGGTGGATGG - Intergenic
949070035 2:242018930-242018952 AGGGAAAGGCAGATGTTGGATGG + Intergenic
1168900947 20:1364335-1364357 CTGGAAAAAGTGATGGTTGATGG + Intronic
1168902111 20:1373795-1373817 CTGGCATGAAAGATGGGGGATGG + Intronic
1169720558 20:8671807-8671829 ATGGAAAGACAGATAGTGGTGGG - Intronic
1170361181 20:15548103-15548125 GTGGACAGATGGATGGTGGATGG - Intronic
1170466251 20:16625086-16625108 TTGGAAAAACAGATTATGGAAGG - Intergenic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1171992773 20:31709130-31709152 CTGGACAGAGGGATGGTTGATGG - Intronic
1172707038 20:36889463-36889485 TTTGAAACACAGATGGTGAAGGG + Intronic
1172849031 20:37947358-37947380 ATGGATAGATAGATGATGGATGG + Intergenic
1173928869 20:46801554-46801576 AGGGAAAGTCAGATGGGGGAGGG + Intergenic
1174289268 20:49496212-49496234 GTGGAAAGACAGATGGTGTACGG - Intergenic
1174570647 20:51498802-51498824 GTAGAAAGACAGATGATGGCAGG + Intronic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175255266 20:57641156-57641178 CTGGGAACTCATATGGTGGAAGG - Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175440117 20:58984470-58984492 TTGGATAGACAGATGGGAGATGG + Intronic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175817253 20:61889719-61889741 ATGGACAGACAGATGGATGATGG + Intronic
1175817282 20:61889859-61889881 ATGGATAGATGGATGGTGGATGG + Intronic
1175906572 20:62382809-62382831 CTGTACAGACAGCGGGTGGAGGG + Intergenic
1176084927 20:63291513-63291535 CGGGACAGCCAGTTGGTGGATGG + Intergenic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1180013400 21:45066174-45066196 CTGGAAAGACTGCTGGTACAAGG + Intergenic
1180299266 22:11023789-11023811 CTAGATAGGCAGATAGTGGAGGG - Intergenic
1180614202 22:17117318-17117340 CTGGAAGCACAGATTGTGCATGG + Exonic
1181061379 22:20283674-20283696 CCTGAAAGGCGGATGGTGGAAGG - Intergenic
1182102739 22:27669567-27669589 GTGGACAGACAGATGGTCTAGGG - Intergenic
1183100052 22:35578396-35578418 CTGGATGGATGGATGGTGGATGG + Intergenic
1183252682 22:36741527-36741549 CTGGAAAGAGAGTGTGTGGAGGG + Intergenic
1183304095 22:37072825-37072847 ATGGATAGACGGATGATGGATGG + Intronic
1183304143 22:37073079-37073101 ATGGATAGACGGATGATGGATGG + Intronic
1184293036 22:43508463-43508485 ATGGATGGACAGATGGGGGATGG - Intergenic
1184362197 22:44025197-44025219 GTGGAAAGGCAGATGGAGAAAGG + Intronic
1184410462 22:44323191-44323213 GTGGACAGATGGATGGTGGATGG - Intergenic
1185018792 22:48361149-48361171 ATGGATAGATAGATGATGGATGG + Intergenic
1185053519 22:48566102-48566124 ATGGATAGATAGATGATGGATGG + Intronic
1185082791 22:48718944-48718966 GGGGACAGACAGATGGTGGAGGG - Intronic
1185196838 22:49476961-49476983 ATGGATAGATAGATGGTGGATGG + Intronic
949519702 3:4838888-4838910 CTGAAAGGACAGATAGTGTAGGG - Intronic
949726124 3:7047447-7047469 CTGGTGAGAGAGATGGTGGTTGG - Intronic
950109823 3:10411910-10411932 CTGGAAATGCAGATGGTGGGTGG - Intronic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
951803755 3:26624055-26624077 ATGTAAATACAGATGGGGGAGGG + Intronic
951880476 3:27476726-27476748 CAGGAAACAAATATGGTGGAAGG - Intronic
952535155 3:34301499-34301521 CTGGAAAGAAAGGAGGTGTATGG - Intergenic
954442379 3:50528756-50528778 CCTGAAAGAGAGCTGGTGGAGGG - Intergenic
954691331 3:52397146-52397168 ATGAAAAGACAGCTGATGGAGGG - Intronic
955146543 3:56325629-56325651 CTATAAAGACAGATGCTGTATGG + Intronic
956896395 3:73665037-73665059 GTGAAAAGACAGAAGGTGGCTGG - Intergenic
957269061 3:78005032-78005054 CTGGAAAAACAGCCAGTGGATGG + Intergenic
957296126 3:78335190-78335212 CTGCAAAGACAGATGGGTAATGG - Intergenic
957357753 3:79114067-79114089 CAGGAAAGACAGCTTGTGCAGGG - Intronic
957498748 3:81025931-81025953 CTGGAAAGACAGGAGGTGTTGGG + Intergenic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959702675 3:109312779-109312801 CTGAGAAGACAGTAGGTGGATGG + Intronic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961174338 3:124821474-124821496 CCTGAAGGACAGAAGGTGGATGG + Exonic
961486983 3:127223503-127223525 CTGTGAAGACAGATGTGGGAGGG + Intergenic
962851932 3:139314399-139314421 CTGGGAAGAAAAATGGGGGAAGG + Intronic
962854163 3:139329280-139329302 CAGGAAGGAGAGAGGGTGGAGGG + Intronic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
963688603 3:148470319-148470341 TTGGAAAAAAAAATGGTGGAGGG + Intergenic
965493134 3:169364690-169364712 CTGGAAAGGCAGGTGATGAATGG - Intronic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
967050585 3:185780214-185780236 CTGGAAAGACAGATAATGAAAGG + Intronic
968946471 4:3667105-3667127 CTGCAAAGTCACATGGTGAATGG - Intergenic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969350301 4:6594437-6594459 CTGGGAGGGCAGCTGGTGGAGGG + Intronic
969424946 4:7118664-7118686 ATGGAAAGATGAATGGTGGATGG + Intergenic
969510540 4:7615057-7615079 GTAGACAGAGAGATGGTGGATGG - Intronic
969510863 4:7617151-7617173 TTGGATAGATGGATGGTGGATGG - Intronic
969528516 4:7716653-7716675 ATGAATAGATAGATGGTGGATGG - Intronic
970249703 4:14101415-14101437 CTGGAAATACAATTGGTGCAGGG + Intergenic
970914975 4:21321961-21321983 AGGGAAAGAGAAATGGTGGAAGG + Intronic
971294868 4:25379089-25379111 CTGGAAAGAGGGGTGGTGGATGG + Intronic
971307505 4:25496472-25496494 CTGGAGAGATAAATGGTGGCAGG - Intergenic
971877968 4:32328628-32328650 GTCGAAAGACAGAGGCTGGAGGG - Intergenic
974631544 4:64496125-64496147 CTGAAAAGACAGCTGGTGTTAGG + Intergenic
974771045 4:66414064-66414086 CAGGAAACACAGATGCTGGAGGG + Intergenic
975215426 4:71748320-71748342 CAAGAAAGACAGGTGGTGGGGGG + Intronic
976631239 4:87238767-87238789 CTGGAAATACATATGATAGAAGG + Intronic
977078929 4:92497712-92497734 CTGGAAAAAAAGATTGTGCAGGG - Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977476759 4:97520164-97520186 AGTGAAAGACAGTTGGTGGAAGG + Intronic
977665827 4:99646414-99646436 ATGGAAACACAGATGGTTAATGG + Intronic
981988217 4:150883566-150883588 TTAAAAAGAGAGATGGTGGAAGG - Intronic
982743940 4:159086830-159086852 CTGGAAAAACAGCTGGTGTGTGG + Intergenic
983301501 4:165931991-165932013 CTGGAAAGCCAGGTGATGGTTGG + Intronic
983739974 4:171118055-171118077 CTGGAAAGACAGATGTGACATGG + Intergenic
983770262 4:171540140-171540162 ATGGATAGATAGATGATGGATGG - Intergenic
983770266 4:171540167-171540189 ATGGATAGATGGATGGTGGAAGG - Intergenic
985132249 4:186750455-186750477 CAGGAAAACCAGATAGTGGATGG + Intergenic
985803420 5:2021275-2021297 CTGGAAAGGCAGAGGGCAGAGGG - Intergenic
986335599 5:6752961-6752983 CGGGGAAGACATGTGGTGGACGG - Exonic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
987176141 5:15312535-15312557 CTGAAAAGAAAGACGTTGGAAGG + Intergenic
987836726 5:23171984-23172006 CTGGCAAGAGAGATGTTGGATGG - Intergenic
988174810 5:27708461-27708483 CTGGAAAGACATTTTGGGGAGGG + Intergenic
988385804 5:30563543-30563565 CTGGCAAGTCAGATGGAGGCTGG + Intergenic
988821230 5:34888129-34888151 CTGTAAACTCACATGGTGGAAGG - Intronic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990494108 5:56329553-56329575 ATGGAAAGCCAGATGGCTGAAGG - Intergenic
991006831 5:61836167-61836189 CTCAAGAGAGAGATGGTGGAAGG + Intergenic
991947666 5:71915330-71915352 CTTGAATGACAGTTGGGGGATGG + Intergenic
992068454 5:73128415-73128437 CAGGAAAGTAAGGTGGTGGAGGG - Exonic
992573981 5:78092135-78092157 TTGAAAGGACAGATGGTGGACGG - Intronic
992681167 5:79154669-79154691 GTGGAAAGAATGATGGTGGGAGG - Intronic
994066257 5:95545899-95545921 CTGGAAATTCAGATTTTGGATGG - Intronic
995402311 5:111757215-111757237 CTAGAAAGACAGATTGGGGGGGG + Intronic
996819129 5:127606363-127606385 CTGCAAAGTCAGACTGTGGAGGG - Intergenic
996922628 5:128786792-128786814 CTGGAGAGAAAGATGATGTAAGG + Intronic
998874919 5:146589436-146589458 ATGGAAAAAAAAATGGTGGAGGG + Intronic
1000420381 5:161031920-161031942 TAGCAGAGACAGATGGTGGAGGG - Intergenic
1000631398 5:163595042-163595064 CTGGAAAGAGAAGTTGTGGAGGG - Intergenic
1000969323 5:167696608-167696630 TAGGAAAAACAGATGGTGAAAGG + Intronic
1001325925 5:170723989-170724011 CAGCAGAGTCAGATGGTGGAGGG + Intronic
1002169194 5:177366056-177366078 CTGGAAAGATAGCAGGTGGCAGG - Intronic
1002341595 5:178519819-178519841 ATGGACAGATAGATGGAGGATGG + Intronic
1002918536 6:1548482-1548504 CTGGAACGGCAGAGGGTGGTGGG - Intergenic
1003497062 6:6673422-6673444 CTAGACAGACAGATGGGGCAGGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1004798762 6:19120665-19120687 CTGGAAAGACAGATCATGAGAGG + Intergenic
1007264944 6:40588891-40588913 CTGGAAAGCCTGGTGGGGGAGGG + Intergenic
1007419534 6:41711497-41711519 CAGGGAAGAGAGATGCTGGAAGG - Intronic
1007556046 6:42767437-42767459 CTGCAAACACAGATGATAGATGG + Intronic
1008241853 6:49123415-49123437 TTGGAAAGACAGAAGGTGTCTGG - Intergenic
1008290615 6:49711324-49711346 TTAGAAAGAAAGAAGGTGGAAGG + Intronic
1008360510 6:50612126-50612148 TTAGAAAAACAGATGGTGGAGGG + Intergenic
1008603643 6:53119577-53119599 CTGGGAAGACAGAATGTGGCAGG - Intergenic
1009917872 6:70018528-70018550 TTGGAATGACAGATCATGGATGG + Intronic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1011713467 6:90079214-90079236 CTGTAGACACAGATGTTGGAGGG - Intronic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013847534 6:114471938-114471960 CTGGAGAGACAGAAGCTGGTAGG - Intergenic
1015680979 6:135808138-135808160 CTGGAGAGACAGAGGGTGACTGG - Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1016272390 6:142303046-142303068 CTGGAAAGCCAGACGGTGCTTGG - Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017703786 6:157100977-157100999 CGGTAAAGTCAGATGGTGGCAGG + Intronic
1017717709 6:157223878-157223900 CGGGACAGACAGGTGCTGGATGG + Intergenic
1017812618 6:157994920-157994942 CTGGAAAGCAAGGTGGTGCAGGG - Intronic
1018324949 6:162656779-162656801 CTGGAAGGCCAGCTGTTGGAAGG - Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018753950 6:166831889-166831911 ATGGATAGATAGATGATGGATGG + Intronic
1018953750 6:168394592-168394614 ATGGAGAGAGAGATGGGGGAAGG + Intergenic
1019326858 7:442743-442765 GTGGAAGGACGGATGGTGGATGG + Intergenic
1019345576 7:528580-528602 ATGAATAGACAGATGATGGATGG + Intergenic
1019345607 7:528802-528824 ATGAATAGACAGATGATGGATGG + Intergenic
1019362580 7:612567-612589 ATGGACCGACAGATGATGGATGG + Intronic
1019480760 7:1265657-1265679 TTGGAGAGACAGATTGTGTATGG + Intergenic
1019557722 7:1641005-1641027 CTGGGAAGAGAGGAGGTGGAGGG - Intergenic
1019594767 7:1853361-1853383 CTGGAAAGAGCGGAGGTGGAGGG + Intronic
1020475583 7:8590196-8590218 CTAGAGAGACAGATACTGGAGGG + Intronic
1022481015 7:30743185-30743207 TTGGAAAGACAGTTGGTGACGGG - Intronic
1023099072 7:36694885-36694907 GAGGATAGACAGATGATGGATGG + Intronic
1023117722 7:36878638-36878660 CTGGTAATACACATGGTGGGTGG + Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024394418 7:48849221-48849243 CTGGACAGAAATATTGTGGATGG - Intergenic
1024400845 7:48923420-48923442 CTGGACAGAAATATTGTGGACGG + Intergenic
1024522774 7:50321143-50321165 CTTGGAAGACTGATGGTAGAAGG + Intronic
1024702001 7:51913773-51913795 ATGGCAAGACAGAGGGTTGACGG + Intergenic
1025270312 7:57505798-57505820 CCAGAAAGACAGGTGGTTGACGG + Intergenic
1026080139 7:67210663-67210685 ATGGATAGACAGATGACGGATGG - Intronic
1026255478 7:68707596-68707618 CTGGACAGGCAGGTGGTGGAGGG - Intergenic
1026531244 7:71199398-71199420 GTGGACAGACAGATGATGGACGG - Intronic
1026696942 7:72603309-72603331 ATGGACAGATAGATGATGGATGG + Intronic
1026696952 7:72603364-72603386 ACGGATAGACAGATGATGGATGG + Intronic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1026828660 7:73598765-73598787 CTGAAAAGTCTGATGATGGAGGG + Intronic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1028669551 7:93385980-93386002 GTGGAAACACAGAGGATGGAGGG + Intergenic
1028830842 7:95324958-95324980 CTTGAAATCCAGATGTTGGAAGG - Intergenic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1031124257 7:117755908-117755930 CTGGAAAGAGAGAACCTGGAGGG - Intronic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1033020696 7:137721571-137721593 CTGGAAAGCAAGCAGGTGGAGGG - Intronic
1033116592 7:138631308-138631330 CTTGAAGGATAGATGGTTGAGGG - Intronic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1034834307 7:154337557-154337579 CAGAAATGACAGATGGTGCAAGG - Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035656810 8:1314545-1314567 TGGGAAAGTCAGATGGTGGCTGG - Intergenic
1036460480 8:8948243-8948265 CTGGAAAGAGAGAAGTTGGCAGG - Intergenic
1037856404 8:22374351-22374373 GTGGAAAGTCAGATGCAGGATGG + Intronic
1038958063 8:32488745-32488767 ATGGAGAGACAGTGGGTGGAGGG + Intronic
1039907738 8:41798614-41798636 CTGGAATGGCAGTTGGTGGCTGG + Intronic
1040352964 8:46587029-46587051 CTGGTGAGACAGAAGGTGTAAGG - Intergenic
1040584391 8:48726252-48726274 ATGGATAGATAGATGATGGATGG - Intronic
1041080940 8:54214346-54214368 CTGGGAAGAATGATGATGGAGGG - Intergenic
1041552179 8:59115665-59115687 CTGGACAGACACATGGAGGCTGG - Intronic
1041780910 8:61577803-61577825 CTAGAGAGACACCTGGTGGAAGG - Intronic
1042810992 8:72824779-72824801 CTGGGAAGAGAGAGAGTGGATGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043511699 8:80956609-80956631 CTGGGAACACTGAGGGTGGAGGG + Intergenic
1044122115 8:88410841-88410863 GAGGAAACACAGAAGGTGGATGG + Intergenic
1044266392 8:90186868-90186890 ATGGAACAACATATGGTGGAAGG - Intergenic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1044900310 8:96937015-96937037 CTGGAAAGAAAAAGGGAGGAAGG - Intronic
1045622596 8:103998806-103998828 TTGGAAAGAGAAATGGTGGTAGG - Intronic
1045731036 8:105241075-105241097 GTGAAAAGACAGAAGATGGAAGG - Intronic
1046495877 8:115012107-115012129 CAGGAAAGAGAGAGGGTGAAGGG + Intergenic
1047898983 8:129398933-129398955 TGGGAAAGATAGATTGTGGAAGG + Intergenic
1048979802 8:139697172-139697194 GTGGACAGATGGATGGTGGATGG + Intronic
1048989285 8:139751909-139751931 GTGGATAGATGGATGGTGGATGG - Intronic
1048989414 8:139752536-139752558 GTGGATAGATGGATGGTGGATGG - Intronic
1049155314 8:141062628-141062650 GTAGATAGACAGATGGGGGAGGG + Intergenic
1049364272 8:142229175-142229197 ATGGATGGACAGATGGTGAATGG + Intronic
1049379914 8:142306947-142306969 CTGGGATGACAGGTGCTGGAGGG - Intronic
1049441760 8:142612842-142612864 CCGGAAAGACAGACGGAGGGAGG + Exonic
1049464907 8:142746690-142746712 GTGGATAGATAGATGGGGGATGG + Intergenic
1049793978 8:144488104-144488126 CTGGAAAGACAGAGGCTGTCAGG - Intronic
1051948314 9:22599248-22599270 CAGAACAGACAGATGTTGGATGG + Intergenic
1054809662 9:69425047-69425069 GTGGGAAGACAGCTGGTGGGAGG - Intergenic
1055657574 9:78467084-78467106 ATGGAATGAGAGATAGTGGAAGG + Intergenic
1056989582 9:91398253-91398275 GTGGATAGACAGATGATAGATGG + Intergenic
1057095479 9:92304235-92304257 CTAGACAGACAAATGTTGGAAGG - Intronic
1057137785 9:92706043-92706065 CTGTAACTTCAGATGGTGGAAGG + Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058643464 9:107109025-107109047 CTGGAAGAAGAGATGCTGGAAGG - Intergenic
1059245756 9:112848463-112848485 CTGCAAAGCCACATGCTGGAAGG + Intronic
1059409082 9:114120795-114120817 CTGGATAGATAGATGATGGATGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060114570 9:120929864-120929886 CTTGTAGGACTGATGGTGGAGGG + Intergenic
1060816809 9:126639342-126639364 CAGGCCAGACAGATGATGGAGGG - Intronic
1061950588 9:133933778-133933800 ATGGATGGACGGATGGTGGATGG + Intronic
1061980952 9:134103380-134103402 CTGGATGGATGGATGGTGGATGG - Intergenic
1061981013 9:134103660-134103682 CTGGAAGGATGGATGCTGGATGG - Intergenic
1062092448 9:134685526-134685548 CTGGATGGATGGATGGTGGATGG - Intronic
1062201271 9:135304094-135304116 ATGGATAGACAGATGATGGAGGG + Intergenic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1185676275 X:1851795-1851817 CTGTAAAGTGACATGGTGGAGGG + Intergenic
1185780559 X:2840942-2840964 ATGGATAGATAGATGATGGATGG + Intronic
1187333688 X:18363553-18363575 CAGGAAAGACACAGGCTGGAAGG - Intergenic
1187375321 X:18747428-18747450 TTAGAAAGTCAGATGCTGGAAGG - Intronic
1188024787 X:25196722-25196744 ATGGAAAGGTAGATGGGGGATGG + Intergenic
1188590117 X:31823270-31823292 CTGGAAAGACACATGCTGACAGG - Intronic
1190336225 X:49264050-49264072 CTGGGAAGGCAGGTGGGGGAAGG + Intronic
1191146047 X:57166185-57166207 ATGGAAAGCCAGAGGGGGGATGG - Intergenic
1191839074 X:65497315-65497337 CTGGAAAGATAGTTTGGGGATGG + Intronic
1194049886 X:89055418-89055440 CTGCAAAGACAAATGTTGGTAGG + Intergenic
1195661974 X:107388172-107388194 AGGAAAAGACTGATGGTGGAGGG - Intergenic
1195811427 X:108835909-108835931 CTGGAAATGGAGATAGTGGATGG - Intergenic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1196890067 X:120283053-120283075 AGGGAAAGACAGATCGGGGAAGG + Intronic
1197290715 X:124653899-124653921 CTTGAAAGACAGATGGGGTGGGG - Intronic
1197547273 X:127840356-127840378 TAGGAAGGACAGTTGGTGGAGGG + Intergenic
1197924798 X:131634975-131634997 AGGAAATGACAGATGGTGGAGGG - Intergenic
1198233104 X:134712263-134712285 CTGGGAAGTCAGATGGGGTATGG - Intronic
1199316445 X:146384122-146384144 CTGGAAAGACAAGTAGTGAAGGG - Intergenic
1201289494 Y:12408923-12408945 ATGGATAGATAGATGATGGATGG - Intergenic
1201289501 Y:12409055-12409077 ATGGATAGATAGATGATGGATGG - Intergenic
1201609832 Y:15828622-15828644 CTGGAATGACAGAAGTTGGGAGG + Intergenic