ID: 1058001812

View in Genome Browser
Species Human (GRCh38)
Location 9:99873455-99873477
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058001805_1058001812 15 Left 1058001805 9:99873417-99873439 CCACTTTAGACTATGGAGATAAG No data
Right 1058001812 9:99873455-99873477 CTGTAGCAAAGGAAGTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058001812 Original CRISPR CTGTAGCAAAGGAAGTTGGA AGG Intergenic
No off target data available for this crispr