ID: 1058002989

View in Genome Browser
Species Human (GRCh38)
Location 9:99885494-99885516
Sequence ATGTAGCAGCATAATGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058002982_1058002989 22 Left 1058002982 9:99885449-99885471 CCTGGTGTGATCTCCATGTTCCA No data
Right 1058002989 9:99885494-99885516 ATGTAGCAGCATAATGACAGTGG No data
1058002987_1058002989 2 Left 1058002987 9:99885469-99885491 CCAAGGGCTATATCTCAGGAACC No data
Right 1058002989 9:99885494-99885516 ATGTAGCAGCATAATGACAGTGG No data
1058002981_1058002989 23 Left 1058002981 9:99885448-99885470 CCCTGGTGTGATCTCCATGTTCC No data
Right 1058002989 9:99885494-99885516 ATGTAGCAGCATAATGACAGTGG No data
1058002985_1058002989 9 Left 1058002985 9:99885462-99885484 CCATGTTCCAAGGGCTATATCTC No data
Right 1058002989 9:99885494-99885516 ATGTAGCAGCATAATGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058002989 Original CRISPR ATGTAGCAGCATAATGACAG TGG Intergenic
No off target data available for this crispr