ID: 1058003638

View in Genome Browser
Species Human (GRCh38)
Location 9:99892845-99892867
Sequence CCTTATATGAAGAGGAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058003634_1058003638 -1 Left 1058003634 9:99892823-99892845 CCTAATCCACTATGGTTAGTGTC No data
Right 1058003638 9:99892845-99892867 CCTTATATGAAGAGGAAATTTGG No data
1058003633_1058003638 0 Left 1058003633 9:99892822-99892844 CCCTAATCCACTATGGTTAGTGT No data
Right 1058003638 9:99892845-99892867 CCTTATATGAAGAGGAAATTTGG No data
1058003635_1058003638 -7 Left 1058003635 9:99892829-99892851 CCACTATGGTTAGTGTCCTTATA No data
Right 1058003638 9:99892845-99892867 CCTTATATGAAGAGGAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058003638 Original CRISPR CCTTATATGAAGAGGAAATT TGG Intergenic
No off target data available for this crispr