ID: 1058006531

View in Genome Browser
Species Human (GRCh38)
Location 9:99922121-99922143
Sequence CTGTGGCCCAGTACTGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058006531 Original CRISPR CTGTGGCCCAGTACTGTGTA AGG (reversed) Intronic
900572372 1:3364969-3364991 CAGGGGCCCAGCACTGGGTAAGG - Intronic
902301457 1:15505541-15505563 CTGAGGCCCAGTAAGGGGTAAGG + Intronic
903647831 1:24905459-24905481 CTGTGGCCCAGTGCTGTGGGGGG + Intronic
904398829 1:30242210-30242232 CTGTGCACCAGCACTGTGTCAGG - Intergenic
906737528 1:48145567-48145589 CTGTGGCCCAAGACTGTTTTTGG - Intergenic
907454960 1:54569504-54569526 ATGAGGCCCAGTCCTGTGAAGGG - Intronic
908104631 1:60828666-60828688 CTGTAGCCCACTACTTTTTAAGG + Intergenic
915315999 1:155029626-155029648 CTGTGGCCCATTCCAGTCTAAGG + Intronic
917453529 1:175166783-175166805 CTGTGGTCAAGTTCTGTGTTGGG + Intronic
917687655 1:177433894-177433916 ATATGGCCAAGTAGTGTGTATGG - Intergenic
919802777 1:201363543-201363565 CTGTGGGCCAGCACTGTGCTGGG - Intronic
920065692 1:203267880-203267902 CTGTGGCCCGGTTCTGTCCAGGG + Intronic
920276392 1:204808133-204808155 CTGTGGCCCAGATCTATATAGGG + Intergenic
920555391 1:206900470-206900492 GTCTGGCCCTGTCCTGTGTAAGG - Intronic
922554252 1:226520991-226521013 CTGTGGCCAAGGCCTGGGTAGGG + Intergenic
923824497 1:237484836-237484858 CTGTGGCCAAGTGCTGTGATGGG - Intronic
924932766 1:248745497-248745519 CTGTGGCCCATCAGTGTGTTTGG + Intronic
1065304896 10:24358675-24358697 CTATGGCCAACCACTGTGTATGG - Intronic
1066450647 10:35525893-35525915 CTGTGGCCAGGTAATGTGTAAGG + Intronic
1068055509 10:52007919-52007941 CTGTAGCCCAAGACTGTGTTTGG - Intronic
1068861418 10:61851685-61851707 CTGTAGCCCAGTATGGTGTCTGG + Intergenic
1071525025 10:86353618-86353640 CTGGGGCCCAGCTCTGTGAAGGG - Intronic
1072027074 10:91470535-91470557 CTGGGACCCAGCACTGTGAAAGG + Intronic
1073850777 10:107615312-107615334 ATGTGGCCCATGACTGTATATGG - Intergenic
1075775445 10:124982471-124982493 TTGTGACACAGAACTGTGTAGGG + Intronic
1075920037 10:126203810-126203832 CTATGGCCCAGTTCTGTGTTGGG + Intronic
1076800786 10:132827136-132827158 CAGTGGCCCAGGACTGGGTGGGG - Intronic
1077768208 11:5184899-5184921 CTCTGGCCTAGAACTGTGTCAGG - Intronic
1079134385 11:17768177-17768199 CTGTGGGCCAGGGCTGTGAAGGG + Intronic
1083662892 11:64260008-64260030 CTGTGGCCCTGTCCTCTGCAGGG + Exonic
1083720728 11:64602283-64602305 CTCTGGCCCAGCGCTGTGTGGGG - Exonic
1084272189 11:68035030-68035052 CTGTGGCCCAGGATGGAGTATGG - Intronic
1085422624 11:76376851-76376873 CTGTGGTCCAGAACTGACTAGGG + Intronic
1087894769 11:103575363-103575385 CTGTGGCCCACAACTCTGGAGGG - Intergenic
1089049592 11:115534711-115534733 CTGTGGTCCAGCACTGTATCAGG - Intergenic
1090734027 11:129595686-129595708 CTGTGTACCAGCGCTGTGTATGG + Intergenic
1091548290 12:1518951-1518973 CTGGAGCCCAGGACTGGGTAGGG + Intergenic
1096480315 12:51935934-51935956 CTCTGGCCCAGTAATCTGTGGGG - Intergenic
1097438284 12:59577459-59577481 CTGAGGCCCAGCACTAGGTATGG + Intergenic
1098295773 12:69002568-69002590 CTGCTGCCCAGTACTGTGTGTGG - Intergenic
1100393688 12:94165984-94166006 ATGTGGCCCAGTCCTGGGCAGGG - Intronic
1101843515 12:108343993-108344015 CTGTGTCCCAGTACTTTGGGAGG - Intergenic
1108389365 13:49933208-49933230 CTGTGGCCAAGAAATGTGGAGGG - Intronic
1110235958 13:73218371-73218393 CTGTTCCCCAGTTCTGTGTTAGG - Intergenic
1111079737 13:83288332-83288354 CTTTGGCCAAGTTATGTGTAAGG + Intergenic
1112706808 13:102079620-102079642 CTGTGCCCCAGTATCATGTATGG - Intronic
1116115598 14:40645587-40645609 CAGAGGCCCAGTACTTTGTGTGG + Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1121015749 14:90547974-90547996 CTGTGGCCCAGCTCTGGGTGGGG + Intronic
1121045666 14:90785759-90785781 CTGTGGCCCAGAGCTGTGGGAGG - Intronic
1124504305 15:30260229-30260251 GTGTGGCCCAGCACTTTGTGAGG - Intergenic
1124739246 15:32278406-32278428 GTGTGGCCCAGCACTTTGTGAGG + Intergenic
1128457684 15:67841473-67841495 CTGTGGCTCAGTACTGAGAGAGG + Intergenic
1129920892 15:79318305-79318327 CTGAGACCCAGGACTGTGTCTGG + Intronic
1131068181 15:89447717-89447739 CTTTGGACCAGGACTGTGTTAGG - Intergenic
1132637435 16:958990-959012 CTGTGGCCTACCACTGTGGATGG + Intronic
1133257697 16:4527563-4527585 CTGTGGCCCCGTGCTGTGGACGG - Intronic
1135924504 16:26680781-26680803 TTGTTGCTCAGTACTGTGAAGGG - Intergenic
1137767182 16:50987071-50987093 CTGAGGCCCAATACTGAGCAAGG + Intergenic
1139737566 16:69005110-69005132 CTGTGGCCCCCAACTGTGTTAGG - Intronic
1139946783 16:70647303-70647325 CAGCGGCCCAGTCCTGGGTATGG + Intronic
1141241590 16:82270106-82270128 CTGTGGGCCAGGAATGTGTTGGG + Intergenic
1141353675 16:83323015-83323037 CTGTGGCCCCCTACAGGGTAGGG - Intronic
1142544509 17:690329-690351 CTGTGGGCCAGTACTGTCCCAGG - Intronic
1144522975 17:15966694-15966716 CTATGCCCCACCACTGTGTACGG - Intronic
1144768206 17:17744383-17744405 CTGTGAACCAGTTCTGTGTGGGG - Intronic
1146764122 17:35503935-35503957 CTGTGGCCCACAACTCTGGAGGG - Intronic
1147810345 17:43164617-43164639 CTGTGGCCCATGACTCTGGAGGG + Intergenic
1147898689 17:43769456-43769478 AAGTGGCCCAGGACTGTGTTGGG + Exonic
1148343452 17:46887837-46887859 CTGGGGCCCAGCACAGTGTTTGG - Intergenic
1150564140 17:66323599-66323621 CTGTGGGCAAGAAGTGTGTATGG + Intronic
1150602033 17:66659457-66659479 CTGTGTCCCAGTACTTTGAGAGG + Intronic
1151618212 17:75228611-75228633 CTGCCGCCCAGAACTGTGCATGG - Intronic
1151750213 17:76032848-76032870 CTGTGGCCCAGGAATCTGCAGGG + Intergenic
1152666154 17:81570760-81570782 CTGTGGCCCAGGGCTGGGCATGG + Intronic
1153586045 18:6621791-6621813 CTGGGGCCCTGTTCAGTGTAAGG - Intergenic
1153746590 18:8185907-8185929 CTGGGGAACAGGACTGTGTATGG - Intronic
1153830344 18:8916976-8916998 CTGTGGCCCATGACTCTGGAGGG - Intergenic
1153970150 18:10218739-10218761 CTGGGACCCACTGCTGTGTAAGG - Intergenic
1155271341 18:24144186-24144208 CTGTGCCCAACTGCTGTGTATGG + Intronic
1157604780 18:48919291-48919313 CTGTGGCCCAGGACAGTATTTGG + Intergenic
1158581857 18:58690890-58690912 CTCTGGCACTGTACTGAGTACGG + Intronic
1160368526 18:78350224-78350246 CTGTGGCTCAGAACAGTGCAGGG + Intergenic
1167102634 19:47413575-47413597 CTTTGCCCCTGTACTCTGTATGG + Intronic
1167285059 19:48594514-48594536 CTGTGGCCCAGTTCTGGGTTTGG - Intronic
931543669 2:63356565-63356587 CTGTGGTCCAGGAGTGTGTTTGG - Intronic
935041981 2:99440344-99440366 CTGTGGCTTACTACTCTGTAGGG - Intronic
935081920 2:99806766-99806788 CTGGAGCCCAGCACAGTGTATGG + Intronic
935233849 2:101121534-101121556 CTGTGTCCCAGGACGGTGAAAGG + Intronic
935280205 2:101510899-101510921 CTGTGGCCCTGTGCTGTGTGAGG + Intergenic
935813641 2:106825821-106825843 CTGGGGTCCAGTCCTGTGTCTGG + Intronic
936243876 2:110809857-110809879 CTGTGGGCCTGTGCTGTGTTAGG + Intronic
940072879 2:149709198-149709220 CTGTGGCCCTGTACAGTGACAGG - Intergenic
946155101 2:217802004-217802026 CTGGGGCCCAGGACTGAGTCTGG - Exonic
948836309 2:240627789-240627811 GTGTGGCCCAGTATTTTGTGGGG - Intronic
1171110436 20:22475994-22476016 CTGAAGCCCAGCAATGTGTACGG + Intergenic
1171292513 20:23990357-23990379 CTGAGGCCCAGAAATGTGAAGGG - Intergenic
1173028235 20:39329758-39329780 CTGTAGCCCATTGCTGTGTCGGG + Intergenic
1173583225 20:44161982-44162004 CTGTGGCCCAGGTGTGTGTGTGG - Intronic
1174723932 20:52841411-52841433 CTGCTGCCCAGAACTGTGTCTGG + Intergenic
1178374923 21:32058868-32058890 CTATGCCCCAGTCCTGTGTATGG - Intergenic
1179485873 21:41710535-41710557 CTGAGCCCCAGTCCTGTGGATGG + Intergenic
1180244681 21:46539134-46539156 CTGGGGCCCAGGACTGTCCAGGG + Intronic
1180823581 22:18848121-18848143 CTGAGGCCCAGAAATGTGAAGGG - Exonic
1181124008 22:20691220-20691242 CTGAGGCCCAGAAATGTGAAGGG - Intergenic
1181189158 22:21126425-21126447 CTGAGGCCCAGAAATGTGAAGGG + Exonic
1181210041 22:21284070-21284092 CTGAGGCCCAGAAATGTGAAGGG - Intergenic
1181399478 22:22642874-22642896 CTGAGGCCCAGAAATGTGAAGGG + Intergenic
1181649938 22:24253194-24253216 CTGAGGCCCAGAAATGTGAAGGG - Intergenic
1181707439 22:24657552-24657574 CTGAGGCCCAGAAATGTGAAGGG + Intergenic
1203216906 22_KI270731v1_random:11363-11385 CTGAGGCCCAGAAATGTGAAGGG + Intergenic
1203273723 22_KI270734v1_random:74027-74049 CTGAGGCCCAGAAATGTGAAGGG - Intergenic
950636104 3:14316038-14316060 CTGTGGCCCAGCACTTTGGGAGG - Intergenic
952833057 3:37581411-37581433 GTGTAGCCCAGGACTGTGCATGG + Intronic
955980273 3:64518350-64518372 CAGTAGCCCATTACCGTGTAAGG - Intronic
957999962 3:87737992-87738014 CTGTGGCCCATGACTCTGGAGGG + Intergenic
961316271 3:126037925-126037947 CAGTGTCCCAGGGCTGTGTAGGG - Intronic
961577720 3:127851803-127851825 CTCAGGCCCAGGACTGTGGATGG + Intergenic
962435937 3:135366821-135366843 CTATGGCAAAGTACTGTGAAAGG + Intergenic
962920357 3:139944629-139944651 CTGTTGCCCAGCACTGTCCAAGG + Intronic
963847483 3:150174067-150174089 CTGAGGCCCAGTAAAGTGAAGGG - Intergenic
963886486 3:150588433-150588455 CTGAGGCTCAGTACTGTCTTTGG + Intronic
964322601 3:155513828-155513850 CTCTGGCCAAGTACTGTTTCAGG + Intronic
972356791 4:38286967-38286989 CTGAGGCCCTGTACAGTGCAGGG - Intergenic
977043608 4:92042826-92042848 CTGTGGCCCACGACTCTGGAGGG + Intergenic
982129592 4:152216210-152216232 CTGTATCCCAGTACTTTGGAAGG + Intergenic
982920449 4:161267362-161267384 CTGTGGCCCTGTAATGGGTGGGG + Intergenic
998938710 5:147257582-147257604 CTGTGGCCCACAACTCTGGAGGG + Intronic
1000924933 5:167181919-167181941 CTGTGTCCAGGTACTGTGTGTGG + Intergenic
1002081916 5:176742423-176742445 CTGTGTCCCAGCACTGAGAATGG - Intergenic
1002999156 6:2314813-2314835 CTGTGGCCCACGACTCTGGAGGG + Intergenic
1005321408 6:24658927-24658949 CTTTGGCCCACTTCTTTGTACGG + Intronic
1005549301 6:26897855-26897877 CTGAGGCCCAGAAATGTGAAGGG - Intergenic
1005549478 6:26898672-26898694 CTGAGGCCCAGAAATGTGAAGGG - Intergenic
1005549654 6:26899492-26899514 CTGAGGCCCAGAAATGTGAAGGG - Intergenic
1006393959 6:33774911-33774933 CTGTGACCCAGTAGGGTGTCTGG + Intronic
1007446115 6:41907406-41907428 CTGTGGACCAATACTGTGCTAGG - Intronic
1008693105 6:54003163-54003185 CTTTGCCACAGTACTGTTTAAGG - Intronic
1009020041 6:57938965-57938987 CTGAGGCCCAGAAATGTGAAGGG - Intergenic
1010687892 6:78873512-78873534 CTGTTGCCCAGTATGGAGTAGGG + Intronic
1012591646 6:100988813-100988835 ATGTGGCCAATTACTGTTTAAGG + Intergenic
1012996381 6:105979828-105979850 CTGAGGCCCAGGACAGTGAAGGG + Intergenic
1015834282 6:137403456-137403478 CTGTGGTCCACTACTGTACATGG - Intergenic
1017599212 6:156062320-156062342 CTGTAGCTCAGTACTGAGTCTGG - Intergenic
1018185288 6:161261298-161261320 ATGTGGCCCAGGACTGTGCCGGG - Intronic
1019910006 7:4094477-4094499 CTGTGGTCCAGTGCTGTGCTAGG + Intronic
1021594850 7:22304010-22304032 CTCTGTCCCAGTACTTTCTATGG - Intronic
1022138238 7:27468996-27469018 GTGAGGCCCAGCACTGTGAAAGG - Intergenic
1022418611 7:30199316-30199338 CTGTGGCCCATTCCTGTGGCTGG + Intergenic
1024812904 7:53234652-53234674 CTGTGGCCCACGACTCTGGAGGG - Intergenic
1026034951 7:66824244-66824266 CTGTGTCCCATGCCTGTGTAGGG + Intergenic
1026076726 7:67178333-67178355 CAGTGGCCCAGTAGAGTGCATGG - Intronic
1026700136 7:72634006-72634028 CAGTGGCCCAGTAGAGTGCATGG + Intronic
1029627532 7:101729686-101729708 GTGTGGCCCAGGGCTGTGTTTGG - Intergenic
1034065533 7:148133203-148133225 CTGTAGTCCAGTACTTTGGAAGG + Intronic
1036412226 8:8512803-8512825 CTGTGGCCCATCACTGTGAAGGG - Intergenic
1036494835 8:9260805-9260827 CTATTGCCCTGTACTGTGTATGG + Intergenic
1038089627 8:24238890-24238912 CTGTGGCCCATGACTCTGGAAGG - Intergenic
1038196975 8:25377598-25377620 CAGTTGCCCAGAACTGTGAATGG - Intronic
1038455504 8:27669870-27669892 CTGTGCCGCAGAACTGGGTACGG + Intronic
1039525419 8:38210402-38210424 CTGGGGGCCAGGACTCTGTACGG + Exonic
1041227104 8:55711612-55711634 CTGTGGCCCATGACTCTGGAGGG - Intronic
1041515429 8:58694422-58694444 CTATGGCCCAGGACTCTGGAGGG - Intergenic
1042087912 8:65128795-65128817 CTGTGGCCCACGACTCTGGAGGG + Intergenic
1042535925 8:69859330-69859352 CTGGGGGCCAGGACTCTGTACGG - Intergenic
1044848903 8:96408761-96408783 CTGGGGACCACTACTGTGGAAGG - Intergenic
1045835522 8:106516440-106516462 CTGGTGCCCAGAACAGTGTAGGG + Intronic
1046578692 8:116064730-116064752 GTGTGGCCCAGTTCTGAGTAAGG + Intergenic
1048470431 8:134699773-134699795 CCGTGTCCCAGTGCTGTGTGAGG - Intronic
1051745659 9:20292710-20292732 CTGTGGCCCAGTGAAGTGAAAGG - Intergenic
1053110784 9:35457940-35457962 TTGTGGCCCAGGACTCTGGAGGG + Intergenic
1058006531 9:99922121-99922143 CTGTGGCCCAGTACTGTGTAAGG - Intronic
1059750343 9:117241707-117241729 CTGTGGACCAGTACAGTCTGTGG - Intronic
1061631408 9:131874429-131874451 CTGTGGCTCAGCACTGGGTACGG + Intronic
1062186780 9:135222456-135222478 CAGGGGCCCAGTACTGTGGCTGG - Intergenic
1062409718 9:136417183-136417205 CTGTGGCCCAGTACACTGGGGGG + Exonic
1186451965 X:9681576-9681598 CTGTGGCCCAGTGCTGCTTGCGG + Intronic
1186977131 X:14919551-14919573 ATGGGGCCCACTACTCTGTAAGG - Intronic
1188922254 X:35991206-35991228 ATGGGGCCTAGTACAGTGTAGGG - Intergenic
1189587549 X:42476364-42476386 CTGTGGACTAGTACTGTCTGTGG + Intergenic
1191716130 X:64194782-64194804 CTGTGGACCAGCACTGAGCATGG + Intronic
1193339638 X:80332895-80332917 CTATGGCCCAGTGCTGTTTAAGG + Intergenic
1195892569 X:109711888-109711910 CTGTGAACCAGTACTGTGCTAGG - Intronic
1198220017 X:134590343-134590365 CTTTGGACCAGTATTGTGTTAGG + Intronic