ID: 1058012999

View in Genome Browser
Species Human (GRCh38)
Location 9:99999020-99999042
Sequence GGCGCAGCTGCTCCTTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058012999 Original CRISPR GGCGCAGCTGCTCCTTGGTG AGG Intronic
900383662 1:2398998-2399020 GATGAAGCTGCTCCTGGGTGGGG + Intronic
900522542 1:3112711-3112733 CGGGCAGCTGCTCCCCGGTGAGG + Intronic
901195794 1:7439134-7439156 GGCCCTGCTGCTCCCAGGTGGGG + Intronic
901850082 1:12009501-12009523 GGCCCAGCTGCTCCCTACTGTGG + Intronic
902400594 1:16154982-16155004 GGCGCAGCGGGTGCGTGGTGGGG - Intronic
902923806 1:19682801-19682823 GGGGCAGCTGCTCCCTGGTGGGG + Exonic
903673959 1:25052942-25052964 GGAGCAGCTGCCACCTGGTGCGG - Intergenic
904684796 1:32252164-32252186 GGTGCAGTTGGTCCTGGGTGAGG + Intronic
904837821 1:33350121-33350143 GGTGCAAGTGCTCCTTGGCGGGG + Intronic
906516311 1:46440809-46440831 GGCCCAGCTGGACCTGGGTGGGG + Intergenic
907851361 1:58258179-58258201 GACACAGCTGCTCCTTCGCGGGG - Intronic
915130111 1:153689937-153689959 AGCGCAGCTGCTCCTGGGGCCGG - Exonic
915405297 1:155655646-155655668 GACGAAGCTGTTGCTTGGTGTGG + Intergenic
916156981 1:161861714-161861736 TGCGTAGATGCTCCCTGGTGAGG + Intronic
917627103 1:176857478-176857500 GGCGCAGCTCCTGCTTTGAGGGG + Intronic
920227274 1:204447815-204447837 GGTGGAGATGCACCTTGGTGAGG + Intronic
920364234 1:205439703-205439725 GGCTGAGCTGCTCCCTGATGAGG + Intronic
922620363 1:226984825-226984847 GGCCCTGGTGCTCCATGGTGCGG - Intronic
923648226 1:235845835-235845857 AGCTCAGCAGCTCCTTGGTTGGG - Intronic
924819942 1:247479545-247479567 GGAGCAGCTGCACCATGCTGTGG - Intergenic
1066207659 10:33205561-33205583 GGGGCAGGTGCTCATTGGTCAGG + Intronic
1067082899 10:43221617-43221639 GGGGCAGCTCCTCCTGGGTCAGG - Intronic
1067187847 10:44045169-44045191 GGCGGAGCTTTTCCTTCGTGGGG + Intergenic
1067753131 10:48984971-48984993 GGGGCTGCTGCTCCTGGCTGTGG + Intergenic
1069819875 10:71220828-71220850 GTCTCAGCTGCTCCTGGCTGAGG + Intronic
1070749465 10:78955391-78955413 GGCTCAGCTGCTCCAAGATGAGG - Intergenic
1074081352 10:110170440-110170462 TGAGCAGCTGCTCCATGTTGGGG - Intergenic
1074141962 10:110680814-110680836 TGCTCAGCTGCTTCTTGCTGGGG + Intronic
1075731230 10:124637939-124637961 GGCCCACCAGCTCCTGGGTGCGG - Intronic
1076815025 10:132910338-132910360 GGCTCAGCTGCTCCTTCCTGCGG - Intronic
1076850157 10:133088618-133088640 GCCGCGGCTGCTCCCTGGCGGGG + Intronic
1076861384 10:133139827-133139849 GGGGCAGCTGCCCGTGGGTGGGG - Intergenic
1077393153 11:2309005-2309027 GGGCCAGCAGCTCCCTGGTGGGG + Intronic
1081493367 11:43583403-43583425 GCTGCAGCTGCTGCTTGGGGCGG + Intronic
1083147084 11:60767744-60767766 GGCACAGCCTCTCCTAGGTGGGG + Intronic
1083685405 11:64372087-64372109 GGCACAGCTACTCCTGGCTGGGG + Exonic
1083887303 11:65579119-65579141 GACGCATCTGCTCCAAGGTGGGG + Exonic
1083889483 11:65588832-65588854 GCAGCAGCCGCTCCTGGGTGTGG + Intronic
1084195666 11:67522672-67522694 GGGGCAGGAGCCCCTTGGTGGGG + Exonic
1084588832 11:70078750-70078772 CGCGCACCTGCGCCTTGGCGAGG + Intronic
1084598916 11:70133403-70133425 CGAGCAGCTGCTCCTTGGTCAGG - Intronic
1084777991 11:71389716-71389738 GACTCAGCTGCTCCTGGTTGAGG + Intergenic
1089213447 11:116821397-116821419 GGCGCAGCTCCTCCACGGTCTGG + Exonic
1091749009 12:3011053-3011075 GGCCCACCTGCTTCCTGGTGCGG - Exonic
1093958755 12:25250758-25250780 GGCTCAGCGGCTCCCAGGTGCGG - Exonic
1096627619 12:52905039-52905061 GGAGAAGCTGCTTCTTGGTGAGG + Intronic
1096693227 12:53333709-53333731 GAAGCAGCTGCTGCTTGATGGGG - Intronic
1101674324 12:106903735-106903757 GGCCCAGCTGCTCCTCGCTACGG - Intergenic
1102304993 12:111798137-111798159 GGCGAAGCTGCTGTGTGGTGGGG + Exonic
1102651773 12:114447521-114447543 GGCGCAGCTGGACCGGGGTGAGG + Intergenic
1103685019 12:122725250-122725272 AGTGCAGCAGCTCCTTGGAGGGG - Intergenic
1104354818 12:128076001-128076023 GACGCATCTGCTCCTTGGAAAGG - Intergenic
1113455051 13:110442505-110442527 CGAGCAGTTGCTCCTTGGAGGGG - Intronic
1113930783 13:113967825-113967847 GGGTCTCCTGCTCCTTGGTGTGG - Intergenic
1113981771 13:114282047-114282069 CCTCCAGCTGCTCCTTGGTGAGG - Exonic
1114075103 14:19157654-19157676 GGCCCAGCTTCTCCTAGGCGCGG - Intergenic
1114075162 14:19157866-19157888 GGCTCCGCTTCTCCGTGGTGCGG - Intergenic
1114087107 14:19242116-19242138 GGCTCCGCTTCTCCGTGGTGCGG + Intergenic
1114087166 14:19242328-19242350 GGCCCAGCTTCTCCTAGGCGCGG + Intergenic
1117164855 14:53023024-53023046 GAGGCAGCTGGTGCTTGGTGGGG + Intergenic
1118603544 14:67487127-67487149 GGCTCAGCTGATCCTTGGCTGGG + Exonic
1118693071 14:68359024-68359046 GTGGCAGCTGCTCCTCTGTGGGG - Intronic
1119485615 14:74984820-74984842 GGGGCAGGGGCTCCTTGGGGAGG + Intergenic
1202899281 14_GL000194v1_random:26299-26321 GGCCCAGCTTCTCCTAGGCGCGG + Intergenic
1124658150 15:31524973-31524995 GGCGAAGCTCCTCCTGGATGGGG + Intronic
1124793468 15:32752387-32752409 GGAGCAGATGCACTTTGGTGCGG - Intergenic
1124971470 15:34494336-34494358 GGCGCCCCTGCTCCTTTGTTCGG - Intergenic
1126467678 15:48975885-48975907 GGCGCAGCGCCCCCTCGGTGCGG + Intergenic
1128310613 15:66629866-66629888 GGTGGAGCTGCTCCGGGGTGGGG + Intronic
1129377833 15:75145340-75145362 GCTGCAGCTGCTCCTTGGGAGGG + Intergenic
1132154624 15:99486746-99486768 GGAGCTGCTGCTCCTGCGTGCGG + Intergenic
1132463011 16:64666-64688 CGCCCAGCTGCTCCATGGGGTGG - Intronic
1132771935 16:1568279-1568301 GGCGGAGCTGGTCCCTGGGGTGG - Exonic
1135126225 16:19811590-19811612 AGAGCAGCTGCTTTTTGGTGGGG - Intronic
1135393179 16:22110890-22110912 GGCTCAGCTGCTCATCGATGAGG - Exonic
1136156131 16:28383448-28383470 TGCCCAGCTGCACCATGGTGCGG + Exonic
1136206955 16:28731840-28731862 TGCCCAGCTGCACCATGGTGCGG - Exonic
1137877895 16:52014730-52014752 AAGGCAGCTGCTCTTTGGTGGGG - Intronic
1141434323 16:83990685-83990707 TGCCCACCTGCTGCTTGGTGGGG + Intronic
1141461817 16:84182295-84182317 GGAGCAGCTGCTTCTGGATGAGG - Exonic
1141979583 16:87541607-87541629 GACGCAGCTGCTCTGCGGTGAGG - Intergenic
1143087457 17:4426779-4426801 GGGGCAGCAGCTGCTAGGTGGGG + Intergenic
1144613490 17:16746712-16746734 CCTCCAGCTGCTCCTTGGTGAGG + Intronic
1145053568 17:19682923-19682945 GGCACAGCTCATCCTTGGTCAGG + Intronic
1145133161 17:20376788-20376810 CCTCCAGCTGCTCCTTGGTGAGG + Intergenic
1145290600 17:21542643-21542665 TGCCCATCTGCTGCTTGGTGGGG - Intronic
1147458720 17:40554819-40554841 GCCGGAGCTGCTCCTGGCTGAGG + Exonic
1148541380 17:48483263-48483285 GGAGCTGATGCTCCTTGATGAGG + Intergenic
1156646809 18:39172908-39172930 GGCTCAGCTGCTACTTGCTCTGG - Intergenic
1157559706 18:48637691-48637713 GGCGTGGCTGCCCCATGGTGTGG + Intronic
1159007007 18:63022379-63022401 GGCGCTGCAGCTCCTTGGATTGG + Intergenic
1159891146 18:73954470-73954492 GAAGCAGCTGCCCCTGGGTGTGG + Intergenic
1159904578 18:74078064-74078086 GGCACAAGGGCTCCTTGGTGAGG + Intronic
1160529392 18:79554790-79554812 GGACCAGCAGCTCCTTGGAGTGG + Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160820720 19:1056467-1056489 CAGACAGCTGCTCCTTGGTGAGG - Exonic
1163038092 19:14583265-14583287 GCCTCAGCTGCCCCATGGTGGGG - Intronic
1164179188 19:22805389-22805411 GGCTCAGCTCTTCCTTGGGGAGG - Intergenic
1165326899 19:35119188-35119210 GCCGCAGCTGCACCGTGGAGTGG - Exonic
1165723476 19:38096119-38096141 CGCCCAGGTGCTCTTTGGTGAGG + Intronic
1166043808 19:40217997-40218019 GGCGCCGCTGCTCCTCGCTGAGG + Exonic
1168103302 19:54152540-54152562 GATAGAGCTGCTCCTTGGTGAGG - Exonic
1168501344 19:56896123-56896145 GCCCCAGCTGCTCCATGGAGTGG - Intergenic
1202648169 1_KI270706v1_random:159368-159390 GGCCCAGCTTCTCCTAGGCGCGG - Intergenic
925155894 2:1648830-1648852 GGCCCAGCTGCTCGTTGGCGCGG + Exonic
925852369 2:8094898-8094920 CGCGAAGATGCTCCTTGGTCTGG + Intergenic
927486182 2:23489825-23489847 TGGGCACCTCCTCCTTGGTGTGG - Intronic
927698973 2:25255880-25255902 GGCGTTGCTGCTCTTTGGAGAGG - Intronic
927883468 2:26704808-26704830 GGAGCGGCTGCTCCATGTTGGGG - Intronic
929557096 2:42932279-42932301 GGCAGGGCTGCTCTTTGGTGGGG - Intergenic
931670416 2:64642278-64642300 GGCCCAGATTCTCCTTGCTGGGG + Intronic
935732398 2:106074764-106074786 AGCCCATCTGCTCCCTGGTGGGG - Intronic
937223395 2:120354582-120354604 GGCGTTGCTGCTCATGGGTGTGG + Intergenic
938259190 2:129883127-129883149 GGCCCAGGTGCTCCTGGGTTTGG - Intergenic
942188232 2:173445197-173445219 GGGGCAGCAGCTCTTTGGTTTGG + Intergenic
943081169 2:183260743-183260765 GGCTCAGCTGCTGCACGGTGAGG + Intergenic
1172272769 20:33663813-33663835 TGCGCGGCTGCTCCTCGGCGGGG - Exonic
1172812221 20:37656737-37656759 AGCGCAGCTGGTCCATGGTGTGG - Intergenic
1172837497 20:37882435-37882457 GGGGCAGCTCCTCCCTGGTTTGG + Intergenic
1176603681 21:8813327-8813349 GGCCCAGCTTCTCCTAGGCGCGG + Intergenic
1176618664 21:9041069-9041091 GGCCCAGCTTCTCCTAGGCGCGG + Intergenic
1176706330 21:10121970-10121992 GGCTCTGCTTCTCCGTGGTGCGG - Intergenic
1178488853 21:33035272-33035294 AGTGCAGCTGCTGCTGGGTGTGG + Intergenic
1180091558 21:45536123-45536145 TGCGCACCTGCCACTTGGTGGGG - Intronic
1180290751 22:10850563-10850585 GGCCCAGCTTCTCCTAGGCGCGG - Intergenic
1180290811 22:10850773-10850795 GGCTCCGCTTCTCCGTGGTGCGG - Intergenic
1180345964 22:11704878-11704900 GGCCCAGCTTCTCCTAGGCGCGG + Intergenic
1180493552 22:15879990-15880012 GGCCCAGCTTCTCCTAGGCGCGG - Intergenic
1180493612 22:15880199-15880221 GGCTCCGCTTCTCCGTGGTGCGG - Intergenic
1183257593 22:36772532-36772554 GGCACAGCTGCTACTTGTTCTGG - Intronic
1183452808 22:37906081-37906103 GGCGGAGCTGCTGCTGGGTGGGG + Intronic
1183662862 22:39231630-39231652 GTCGCAGCTGCACCTGGGTGGGG + Exonic
1183678885 22:39315291-39315313 GGCCCAGCTGTTCGTTGATGAGG - Intronic
1185341505 22:50293315-50293337 GGCGCTGCTCCTCCCTGGTAGGG - Intronic
1185347315 22:50316282-50316304 GCAGCAGCTTCTCCTTGGGGAGG - Intronic
950193425 3:10993081-10993103 GGCGCCTCTGCTCCTTCATGTGG - Intronic
950967112 3:17154262-17154284 GGCCAACCTGCTCTTTGGTGAGG - Intergenic
953810407 3:46107944-46107966 GGCACAGCATCTCTTTGGTGGGG - Intergenic
953912179 3:46898788-46898810 CGCGCAGCTCCTCCTCGGTGAGG - Exonic
955864984 3:63372567-63372589 GGCACAGCTGCCCCTGGGTTGGG + Intronic
956053994 3:65279245-65279267 GGGGAAGCTGACCCTTGGTGGGG + Intergenic
956662297 3:71611083-71611105 TGGGCAGCTGCCCCTTGATGTGG - Intergenic
959936228 3:112031864-112031886 GGGGCTGCTTCTCCTTGGAGTGG + Intergenic
962318150 3:134371370-134371392 AGCGCAGCTGCTCCTGGATGAGG + Exonic
962808895 3:138945773-138945795 GGCGCGGCGGCCCCGTGGTGCGG + Exonic
967017632 3:185496404-185496426 GAGCCAGCTGCTGCTTGGTGGGG - Intronic
968273394 3:197422206-197422228 GGCGCACCTGCTCCATTGTGGGG + Intergenic
968911078 4:3477280-3477302 GGGGCAGCTGCTCATTGGCCGGG + Intronic
969782364 4:9417568-9417590 GGTAAAGCTGCTACTTGGTGTGG - Intergenic
973374442 4:49277518-49277540 GGCCCAGCTTCTCCTAGGCGCGG - Intergenic
973382969 4:49332723-49332745 GGCCCAGCTTCTCCTAGGCGCGG + Intergenic
973386595 4:49517765-49517787 GGCCCAGCTTCTCCTAGGCGTGG + Intergenic
975908339 4:79242228-79242250 GGCCCACCTGCACCTTGGAGGGG + Intronic
981670335 4:147279455-147279477 GCTACAGCTGCTCCTTGGTTGGG - Intergenic
985775621 5:1840348-1840370 GGCCCAGATGGTCCTGGGTGAGG + Intergenic
987132967 5:14875724-14875746 GCTGCAGATGTTCCTTGGTGAGG - Intergenic
988520888 5:31944790-31944812 GCTGCAGCTGCGCCTTGGAGGGG + Intronic
992624972 5:78628521-78628543 GGGGCTGCTGCTCCTTTGAGCGG - Intronic
995913438 5:117215060-117215082 GTGGCACCTGCTTCTTGGTGTGG - Intergenic
997695272 5:135856516-135856538 GGTGCTGCTGCTCCTTGCTGGGG + Intronic
999383345 5:151137255-151137277 GGTGCATCTGCTCATTGGTCCGG + Exonic
1000029380 5:157389218-157389240 AGCACAGCCGCTCCTTGGTCAGG - Exonic
1002921124 6:1574229-1574251 GGCAACGCTTCTCCTTGGTGAGG - Intergenic
1004504735 6:16238671-16238693 GGTGCAGCGGCTCCTGGCTGCGG - Exonic
1005391844 6:25341937-25341959 GGCACAGGTGCACTTTGGTGCGG + Intronic
1006414923 6:33897869-33897891 GGTGCATCTGTCCCTTGGTGAGG - Intergenic
1007112696 6:39322225-39322247 GGGGCATCAGCTCCTGGGTGAGG + Intronic
1007393056 6:41561537-41561559 TGTTCAGCTGCTCCTTGCTGAGG + Intronic
1007934875 6:45723896-45723918 GGCATAGCTGCTTCCTGGTGAGG - Intergenic
1008402312 6:51078157-51078179 GGCTCAGCCTCTCCTTGGGGAGG + Intergenic
1013073631 6:106751588-106751610 GCTGCAGCTGCTCCTGGTTGGGG - Intergenic
1013111842 6:107070494-107070516 GGCTCACCTGCTTCTTGATGCGG + Exonic
1013391515 6:109690562-109690584 CACGCACCTGCTGCTTGGTGGGG + Intronic
1013429081 6:110040019-110040041 GGCGCAGCTGCTCTTCGGAGAGG - Intergenic
1015747505 6:136526165-136526187 GGGGAAGCTGCTGCTAGGTGAGG - Intronic
1018845658 6:167553512-167553534 GGCTCCACTGCTCCCTGGTGGGG + Intergenic
1020136935 7:5592853-5592875 GGCGCCCCTGCTCCTTTGTTCGG - Exonic
1021614484 7:22488164-22488186 GGGGCAGTTGCTCCTTGGGAGGG - Intronic
1022794185 7:33719025-33719047 TGGGCTGCTACTCCTTGGTGGGG + Intergenic
1032091533 7:128913972-128913994 AGTCCAGCTGCACCTTGGTGGGG + Intergenic
1032473956 7:132199768-132199790 GGAGAAGCTGCCACTTGGTGGGG - Intronic
1033587591 7:142786119-142786141 AGAGCAGCTGCTCCTTTGAGGGG - Intergenic
1034883079 7:154777248-154777270 GGCACCTCTGCTCCTAGGTGTGG - Intronic
1034898813 7:154894893-154894915 GCAGCAGCTGCTCCATGGTCGGG - Intergenic
1035105149 7:156435722-156435744 GGGACTGCTGCTCCTTAGTGGGG - Intergenic
1036836702 8:12076562-12076584 GGTAAAGCTGCTACTTGGTGTGG + Intergenic
1036858546 8:12323130-12323152 GGTAAAGCTGCTACTTGGTGTGG + Intergenic
1037207996 8:16348191-16348213 GGAGCACCTGCTCTTTGGTTTGG + Intronic
1038664138 8:29522850-29522872 GGCCCATCTGCTCCATGGAGAGG + Intergenic
1039771686 8:40694178-40694200 GGAGAAGCTGCTGCTGGGTGTGG + Intronic
1039922967 8:41906119-41906141 GGCTCAGGTGCTCCTTGGCTTGG + Intergenic
1040859475 8:51984247-51984269 GGTGCAGCTGGCCCTGGGTGAGG - Intergenic
1041007058 8:53505530-53505552 GCTGGAGCTGCTCCTTAGTGAGG + Intergenic
1042215972 8:66429845-66429867 GGGGCACCTTCTCCTTGGGGAGG - Exonic
1042589504 8:70383268-70383290 GGTCCAGCTCCTCCTTGGTGAGG - Intronic
1049261873 8:141643553-141643575 GGCGCTGGTGTTCCTTGGTGAGG + Intergenic
1049357603 8:142196422-142196444 GGCACTGCTGCCCCTCGGTGTGG + Intergenic
1049657005 8:143803445-143803467 GGTGCAGCTGCTCCGCAGTGTGG - Exonic
1049731302 8:144179932-144179954 GGCTCTGCTGCTCCTGCGTGTGG + Intronic
1049731314 8:144179987-144180009 GGCTCTGCTGCTCCTGCGTGTGG + Intronic
1050526246 9:6549334-6549356 AGAGCAGCTGCTCCGGGGTGGGG + Intronic
1053643617 9:40109089-40109111 GGCTCTGCTTCTCCGTGGTGCGG - Intergenic
1053762536 9:41356402-41356424 GGCTCTGCTTCTCCGTGGTGCGG + Intergenic
1054324475 9:63706314-63706336 GGCTCTGCTTCTCCGTGGTGCGG - Intergenic
1054541134 9:66267516-66267538 GGCTCTGCTTCTCCGTGGTGCGG + Intergenic
1056180348 9:84076618-84076640 GGCCCAGTTGCTCTTTGGTCAGG - Intergenic
1056851499 9:90088340-90088362 GGTGCATCTGCTCCTTGCTGTGG + Intergenic
1057353320 9:94317654-94317676 GAAGCAGATGCTCCTTGCTGTGG - Intergenic
1057654431 9:96939938-96939960 GAAGCAGATGCTCCTTGCTGTGG + Intronic
1057767009 9:97930097-97930119 GGCCCACCTGTTTCTTGGTGTGG + Exonic
1058012999 9:99999020-99999042 GGCGCAGCTGCTCCTTGGTGAGG + Intronic
1059340944 9:113597222-113597244 GGAGCTGCTGCTCCCTGCTGCGG + Exonic
1060549776 9:124479427-124479449 GGCCCAGGTGCTTCTTGCTGAGG + Intergenic
1061057951 9:128234092-128234114 GGCTCACCTGCTCCTTAGTGCGG - Exonic
1061571222 9:131478556-131478578 GGCGGCGCTGCTTCTTGGTCAGG - Exonic
1061855602 9:133440450-133440472 GGGGCAGCCGGTCCTCGGTGAGG - Exonic
1061858366 9:133455453-133455475 GGAGCAGCGGCTTCTTCGTGGGG - Exonic
1061936465 9:133860456-133860478 GGCGCAGTTGCCCCTTGGTGGGG - Intronic
1062264604 9:135681278-135681300 GGAGCAGCTGACCCTTGGTGTGG - Intergenic
1202791367 9_KI270719v1_random:92059-92081 GGCTCTGCTTCTCCGTGGTGCGG - Intergenic
1203698108 Un_GL000214v1:115426-115448 GGCCCAGCTTCTCCTAGGCGCGG - Intergenic
1185849875 X:3475384-3475406 GGCTGAGTTGCTCCTGGGTGGGG - Intergenic
1198226751 X:134652442-134652464 GGTGCAGCTGGCCCTTGGTCAGG + Intronic
1198286241 X:135194610-135194632 GGCGCTGCTGCTCTGTGGGGTGG + Intergenic
1200070826 X:153528318-153528340 GCCGCATGTGCTCTTTGGTGGGG + Intronic
1200244603 X:154516266-154516288 GGCGCAGCTGCTGCCGGGGGCGG - Intergenic
1201152366 Y:11101156-11101178 GGCCCAGCTTCTCCTAGGCGCGG + Intergenic