ID: 1058015608

View in Genome Browser
Species Human (GRCh38)
Location 9:100029304-100029326
Sequence TTGTTGTTGCTTGTATATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1098
Summary {0: 1, 1: 0, 2: 7, 3: 67, 4: 1023}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058015608_1058015610 10 Left 1058015608 9:100029304-100029326 CCAGAATATACAAGCAACAACAA 0: 1
1: 0
2: 7
3: 67
4: 1023
Right 1058015610 9:100029337-100029359 ATCCTATTTTAAAAAGGACATGG No data
1058015608_1058015609 4 Left 1058015608 9:100029304-100029326 CCAGAATATACAAGCAACAACAA 0: 1
1: 0
2: 7
3: 67
4: 1023
Right 1058015609 9:100029331-100029353 AACAAAATCCTATTTTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058015608 Original CRISPR TTGTTGTTGCTTGTATATTC TGG (reversed) Intronic
900005459 1:44800-44822 TTTGTGTTACTTGTATATTCTGG - Intergenic
902102384 1:14002121-14002143 TTTAAGTTCCTTGTATATTCTGG - Intergenic
902119348 1:14148922-14148944 TTGTTTTGGCTTTTATATTTTGG + Intergenic
903311368 1:22459672-22459694 CTGTTTTTGCTTGTTTATTCTGG + Intronic
903784578 1:25850200-25850222 TTGTTGTTGTTTTTAGAATCAGG - Intronic
904660642 1:32081903-32081925 TTTTGGTTTCTTGTATATCCTGG + Intronic
904845549 1:33411460-33411482 TTGTTGTTGTTGTTATATTAAGG + Intronic
905438127 1:37973468-37973490 TTGTAGTTCTTTGTAGATTCTGG - Intronic
905757772 1:40525925-40525947 TTTGAGTTCCTTGTATATTCTGG - Intergenic
905836873 1:41132416-41132438 TTGTTTTTCTTTGTAAATTCTGG + Intronic
906082870 1:43105614-43105636 TTGTTTTTGCTTGTACTTTTGGG + Intergenic
906915053 1:50000192-50000214 TTTTAGTTCCTTGTAGATTCTGG - Intronic
907633031 1:56103599-56103621 TTTGAGTTTCTTGTATATTCTGG + Intergenic
907696312 1:56733102-56733124 TTTGAGTTCCTTGTATATTCTGG - Intronic
908065946 1:60404832-60404854 TTTGAGTTCCTTGTATATTCTGG + Intergenic
908447985 1:64219941-64219963 TCTTTGTTCGTTGTATATTCTGG + Intronic
908701170 1:66902429-66902451 TTGTAGTTATTTATATATTCTGG + Intronic
908735902 1:67276703-67276725 TTGAAGTTCCTTGTAGATTCTGG - Intergenic
909268339 1:73591192-73591214 TTGCTATGGCTTGTATAATCTGG - Intergenic
909592369 1:77365236-77365258 TTTGAGTTCCTTGTATATTCTGG + Intronic
910373856 1:86548317-86548339 TTTGAGTTTCTTGTATATTCTGG + Intronic
911223217 1:95274505-95274527 TTTGAGTTCCTTGTATATTCTGG - Intergenic
912005721 1:104898101-104898123 TTTTGGTCCCTTGTATATTCTGG + Intergenic
912299019 1:108494299-108494321 TTGGTGTTCATTGTAGATTCTGG - Intergenic
912346187 1:108965473-108965495 TTTTGGTTCCTTATATATTCTGG + Intergenic
912771560 1:112468676-112468698 TTTGAGTTCCTTGTATATTCTGG + Intronic
912880327 1:113405938-113405960 TTGGTTTTGCTTACATATTCAGG + Intronic
913038410 1:114998288-114998310 TTGCTGTTCCTTGAACATTCTGG + Intergenic
913402999 1:118456586-118456608 TTTGAGTTCCTTGTATATTCTGG - Intergenic
913416317 1:118612551-118612573 TTTAAGCTGCTTGTATATTCTGG + Intergenic
913417766 1:118630635-118630657 TTTGAGTTCCTTGTATATTCTGG + Intergenic
914234662 1:145798016-145798038 TTGTTGTTCTTTCTACATTCTGG + Intronic
915767460 1:158378274-158378296 TTTGAGTTCCTTGTATATTCTGG - Intergenic
915785082 1:158601907-158601929 TTTGAGTTTCTTGTATATTCTGG - Intergenic
915800435 1:158786127-158786149 TTTGTGTTCCTTGTAGATTCTGG - Intergenic
916277624 1:163012346-163012368 TTGGCGTTCCTTGTAGATTCTGG + Intergenic
916539438 1:165738292-165738314 TTGTTGTTGTTTGTTTGTTTTGG - Intronic
916794828 1:168156211-168156233 TTTGAGTTCCTTGTATATTCTGG + Intergenic
916924769 1:169506572-169506594 TTTAAGTTGCTTGTAGATTCTGG - Intergenic
916940305 1:169669892-169669914 TTGAAGTTCCTTGTAGATTCTGG - Intronic
916970495 1:170008389-170008411 TTGAAGTTCCTTGTAGATTCTGG - Intronic
916978122 1:170103781-170103803 TTGACGTTCCTTGTAGATTCTGG + Intergenic
917009267 1:170452613-170452635 TTGAAGTTGCTTGTAGATTCTGG + Intergenic
917156690 1:172008076-172008098 TTTGAGTTCCTTGTATATTCTGG + Intronic
917264838 1:173210062-173210084 TTGTTGTTGTTTGGATTTTTTGG + Intergenic
917803205 1:178589388-178589410 TTTGAGTTCCTTGTATATTCTGG + Intergenic
917816315 1:178713359-178713381 CTTTTTTTGCTTGTATATCCTGG - Intergenic
917945317 1:179963788-179963810 TTCTTTTTGCTTGGCTATTCAGG + Intronic
917991478 1:180384273-180384295 TTTGAGTTTCTTGTATATTCTGG - Intronic
918006302 1:180544795-180544817 TTGTTGTTGTTTGTTTAGACAGG - Intergenic
918573766 1:186030342-186030364 TTTTTGTTCCGTGTATATTGGGG + Intronic
918671754 1:187225640-187225662 TTGTAGGTGCTTGTATTTACAGG - Intergenic
918695196 1:187537417-187537439 TTGTAGTTCTTTTTATATTCTGG + Intergenic
918771248 1:188563421-188563443 TTGTAGCTGCTAGTATATTTGGG + Intergenic
919017887 1:192064177-192064199 TTTGAGTTTCTTGTATATTCTGG - Intergenic
919030608 1:192237423-192237445 TTATTGTTGTTTTTATATTGAGG - Intergenic
919075821 1:192811437-192811459 TTGTAGCTTCTTGTATATTCTGG - Exonic
919215900 1:194553920-194553942 TTTATGTTCCTTGTAGATTCTGG + Intergenic
919446008 1:197706550-197706572 TTTGAGTTCCTTGTATATTCTGG - Intronic
921073447 1:211681501-211681523 TTCCTGTTACTTGTAAATTCAGG + Intergenic
921280833 1:213566033-213566055 TTGTTGTTGCTCTTTTATTTGGG - Intergenic
921450776 1:215303025-215303047 TTGTTGTTGTTTGTTTGTTTTGG - Intergenic
921457790 1:215393242-215393264 TTGCTGTTCTTTATATATTCTGG - Intergenic
921497206 1:215856306-215856328 TTTGAGTTGCTTGTAGATTCTGG - Intronic
921698279 1:218237608-218237630 TTATTGTTCTTTGTAGATTCTGG - Intergenic
921956378 1:220988151-220988173 TTTGAGTTCCTTGTATATTCTGG + Intergenic
922066698 1:222150945-222150967 TTTAAGTTCCTTGTATATTCTGG - Intergenic
922384268 1:225066363-225066385 CTTTTGTTGCTTGTGTTTTCAGG + Intronic
923118770 1:230970403-230970425 TCTTAGTTGCTTGTATTTTCAGG + Intronic
923479522 1:234370295-234370317 TTTGTGTTATTTGTATATTCTGG + Intergenic
923827785 1:237519145-237519167 TGTTTGTTTCTTGCATATTCTGG + Intronic
923834950 1:237600720-237600742 TTTGTGTTCCTTATATATTCTGG - Intronic
924069405 1:240260624-240260646 TTTGTGTTCCTTGTAGATTCTGG + Intronic
924162033 1:241242851-241242873 TTGGAGTTCCTTGTACATTCTGG + Intronic
924283063 1:242457585-242457607 TTGTTGTTGCATGCATTTTCAGG - Intronic
924479886 1:244420050-244420072 TGTTTTTAGCTTGTATATTCAGG - Intronic
924649632 1:245913743-245913765 TTTGAGTTCCTTGTATATTCTGG - Intronic
1063436092 10:6032782-6032804 TTGTTTTTCTTTATATATTCTGG - Intronic
1063756493 10:9016328-9016350 TAGTTGTGGTTTGTATTTTCAGG - Intergenic
1064077864 10:12284490-12284512 TTGGAGTTCCTTGTAGATTCTGG + Intergenic
1064240960 10:13628110-13628132 TTGTTGTTCCCTGTGTAATCAGG - Intronic
1064680240 10:17804281-17804303 TTGTAGTTGTTAATATATTCTGG + Intergenic
1065426399 10:25608814-25608836 TTTAAGTTCCTTGTATATTCTGG - Intergenic
1065623174 10:27604665-27604687 TTGTTGTTGTTTTACTATTCAGG - Intergenic
1065748961 10:28867981-28868003 TTGTTTTTCTTTGTAGATTCAGG + Intronic
1066175209 10:32896228-32896250 TTGTAGTTATTTATATATTCTGG + Intergenic
1067000202 10:42603926-42603948 TTGTTGTTTCTTATTTATTTAGG - Intronic
1067132619 10:43578590-43578612 TTGGAGCTCCTTGTATATTCTGG + Intergenic
1067396439 10:45924325-45924347 TTGTAGTTCTTTATATATTCTGG + Intergenic
1067864760 10:49893433-49893455 TTGTAGTTCTTTATATATTCTGG + Intronic
1067906912 10:50301514-50301536 TCTGTGTTCCTTGTATATTCTGG - Intergenic
1067973201 10:50993831-50993853 TTGTTGTTGTTTGTATGTACTGG + Intronic
1068011599 10:51458288-51458310 TTATTGTTGTTTCTATTTTCTGG + Intronic
1068237257 10:54254323-54254345 TTTATGTTGCTAGTATATCCTGG - Intronic
1068253426 10:54474135-54474157 TTTTTCTTGCTTGTAAATTATGG + Intronic
1068365951 10:56050162-56050184 TCTTTGTTGCTTGTATTTTGAGG - Intergenic
1068411184 10:56657414-56657436 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
1068553332 10:58430299-58430321 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1068608019 10:59027008-59027030 TTGTTGTTGTTTGTAGAGACAGG + Intergenic
1068664798 10:59662255-59662277 TTTATGTTCCTTGTAGATTCTGG - Intronic
1068871104 10:61946194-61946216 TAGTTTTTGCTTGGAGATTCTGG + Intronic
1070235491 10:74620933-74620955 TTTAAGTTCCTTGTATATTCTGG + Intronic
1071059528 10:81553391-81553413 TTTATGTTCCTTGTAAATTCTGG - Intergenic
1071208973 10:83316270-83316292 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1071581895 10:86779489-86779511 TTTGAGTTACTTGTATATTCTGG + Intronic
1071689158 10:87797181-87797203 TTTTTGTTGTTTGTTTGTTCTGG + Intronic
1072297207 10:94021385-94021407 TTGTTTTAGATTTTATATTCTGG + Intronic
1072380802 10:94867844-94867866 TTTAAGTTCCTTGTATATTCTGG + Intergenic
1072737539 10:97889221-97889243 TTGGTGTTGTTTTTATTTTCCGG + Intronic
1072876660 10:99180377-99180399 TTTAAGTTGCTTGTAGATTCTGG - Intronic
1072879744 10:99214713-99214735 TTTAAGTTGCTTGTAGATTCTGG - Intronic
1072952976 10:99864336-99864358 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
1073934116 10:108610123-108610145 TTGTTCTGTCTTGTATATCCTGG + Intergenic
1074015831 10:109532763-109532785 TTTTAGTTTCTTGTAGATTCTGG + Intergenic
1074581990 10:114728014-114728036 TAGGTGTTGTTTGTAAATTCTGG - Intergenic
1074630334 10:115247277-115247299 TTTTAGTTCTTTGTATATTCTGG - Intronic
1074633657 10:115288904-115288926 TTTTAGTTCCTTATATATTCTGG + Intronic
1074838170 10:117320559-117320581 TAGTTTTAGCTTTTATATTCAGG - Intronic
1074912790 10:117926825-117926847 TTGTTGTTGTTTGTTTGTTTTGG - Intergenic
1074960527 10:118441095-118441117 TTTTTTTTGCTTTTCTATTCAGG + Intergenic
1074979349 10:118607349-118607371 CAGTTGTTGCATTTATATTCAGG + Intergenic
1075259234 10:120948840-120948862 TTGTTGTTCATTGTAGATTCTGG + Intergenic
1075342099 10:121655292-121655314 TTGTTGTTGTTTGTTTTTTAAGG + Intergenic
1076274770 10:129188100-129188122 GTGTAGTTACTTATATATTCAGG - Intergenic
1076663905 10:132074552-132074574 TTGGGGTTCCTTGTAGATTCTGG + Intergenic
1077450637 11:2641508-2641530 TTGGAGTTCCTAGTATATTCTGG + Intronic
1078123533 11:8535359-8535381 TTTGAGTTCCTTGTATATTCTGG - Intronic
1078588382 11:12615411-12615433 TTTTAGTTCCTTGTAGATTCTGG - Intergenic
1078688355 11:13553987-13554009 TTGTTTTTGATTGGCTATTCTGG - Intergenic
1078978858 11:16508002-16508024 TTTTAGTTTCTTGTAAATTCTGG - Intronic
1079044591 11:17089907-17089929 TTGTTGTAGCTTGTATACAGTGG - Exonic
1079262092 11:18892448-18892470 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
1079271396 11:18989600-18989622 TTGTAGTTCTTTGTAGATTCTGG + Intergenic
1079271877 11:18994883-18994905 TTTTAGCTCCTTGTATATTCTGG + Intergenic
1079275517 11:19032539-19032561 TTGTAGTTCTTTGTAGATTCTGG + Intergenic
1079318171 11:19427601-19427623 TTGTTGTTGTTTTTAATTTCTGG + Intronic
1079342680 11:19625903-19625925 TTTGAGTTCCTTGTATATTCTGG + Intronic
1079511803 11:21219353-21219375 TTTGAGTTCCTTGTATATTCTGG + Intronic
1079529592 11:21434064-21434086 TTTGTGGTCCTTGTATATTCTGG + Intronic
1079951236 11:26807732-26807754 TTATTATTCCTTGCATATTCAGG + Intergenic
1079956109 11:26866740-26866762 TAGTAATTGCTTGTATATTCTGG - Intergenic
1079980028 11:27141140-27141162 TTGTTGTTGTTTGTTTCTTATGG - Intergenic
1080362837 11:31535905-31535927 ATGTTGTTGCATGTATAGTCAGG + Intronic
1080772306 11:35352952-35352974 TTGTCATTGCTTTTATATTGAGG - Intronic
1081020000 11:37933837-37933859 TTGTTGTTCCTTCTATTTTTGGG + Intergenic
1081040494 11:38204555-38204577 TTAATGTTCCTTGTAGATTCTGG - Intergenic
1081315928 11:41629860-41629882 TTGTTGTTGTTTGTAGAGACAGG + Intergenic
1081328857 11:41779611-41779633 TTGTTGGTGTTTGTTTATTGAGG - Intergenic
1081985377 11:47298553-47298575 TTTTTCTTTCTTGTATATTCTGG + Intronic
1082571261 11:54743261-54743283 TTGGAGTTGATTGTAGATTCTGG + Intergenic
1082601880 11:55168400-55168422 TTGGTGTTCATTGTAGATTCTGG + Intergenic
1082648674 11:55759795-55759817 TTGGTGTTCATTGTAGATTCTGG + Intergenic
1082712292 11:56567585-56567607 TTTATGTTTCTTATATATTCTGG + Intergenic
1082903147 11:58278195-58278217 TTTAAGTTCCTTGTATATTCTGG + Intergenic
1084052978 11:66613008-66613030 TTGTTGTTGTTTGTTTGTTTTGG - Intergenic
1085955246 11:81385339-81385361 TTGGAGTTCCTTGTAAATTCTGG - Intergenic
1086254678 11:84861727-84861749 TTTTTGTTCCTTATAGATTCTGG - Intronic
1086513437 11:87585723-87585745 TTTTTGTTTGTTGTAGATTCTGG + Intergenic
1086522891 11:87690857-87690879 TTTGTGTTCCTTGTATATTCCGG - Intergenic
1086563266 11:88193610-88193632 TTTTTGTTCCTTATAGATTCTGG + Intergenic
1086844996 11:91737996-91738018 TTTTTGTTCATTGTAGATTCTGG - Intergenic
1086847136 11:91764980-91765002 TTGGAGTTCCTTCTATATTCAGG + Intergenic
1087353652 11:97065799-97065821 TTTGTGTTCCTTGTACATTCTGG - Intergenic
1087786653 11:102362176-102362198 TTGTTTTTGGTTTTATATTTAGG + Intronic
1088197434 11:107290969-107290991 TTTGAGTTTCTTGTATATTCTGG + Intergenic
1088215933 11:107509372-107509394 TTGTTGTTCTTTATATATTATGG + Intronic
1089710622 11:120311897-120311919 TTGTAGTTTCTTGTCTTTTCTGG - Intronic
1090276453 11:125423368-125423390 TTATTGTTGAACGTATATTCAGG - Intronic
1090853425 11:130590739-130590761 TTTGAGTTCCTTGTATATTCAGG + Intergenic
1090911573 11:131124255-131124277 TTGTGTTCCCTTGTATATTCTGG + Intergenic
1091494519 12:960635-960657 TTGTTGTTGTTTGTAAAGACAGG + Intronic
1091713308 12:2758130-2758152 TTTGTGTTCCTTGTAGATTCTGG - Intergenic
1092701645 12:11238109-11238131 TTTGGGTTTCTTGTATATTCTGG + Intergenic
1092979000 12:13774842-13774864 TTAGTGTCACTTGTATATTCTGG - Intronic
1093212222 12:16321535-16321557 TGTTTGTTTCTTGTATAGTCTGG + Intergenic
1093606686 12:21099045-21099067 TTTGAGTTCCTTGTATATTCTGG + Intronic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1094158025 12:27358170-27358192 TTGGAGTTCCTTGTAGATTCTGG - Intronic
1094328405 12:29265784-29265806 TTTGTGTTCCTTATATATTCTGG - Intronic
1094440386 12:30469497-30469519 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1094683496 12:32687261-32687283 TAGTTTTGGCTTGTATATTTAGG + Intronic
1094714901 12:33003314-33003336 TTTGAGTTTCTTGTATATTCTGG + Intergenic
1095041736 12:37449969-37449991 TTGGAGTTGATTGTAGATTCTGG - Intergenic
1095090114 12:38096585-38096607 TTGGAGTTGATTGTAGATTCTGG - Intergenic
1095134510 12:38583375-38583397 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
1095224323 12:39661524-39661546 TTTGAGTTTCTTGTATATTCTGG + Intronic
1095829107 12:46564243-46564265 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1095883067 12:47159607-47159629 TCGGTTTTCCTTGTATATTCTGG + Intronic
1096039901 12:48505821-48505843 TTATTGTTCTTTGTATATTTTGG - Intergenic
1097498109 12:60368435-60368457 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1097653926 12:62338347-62338369 TTTATGTTCCTTGTAGATTCTGG + Intronic
1097833240 12:64247711-64247733 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1098003924 12:65975151-65975173 TTTTAGTTCCTTGTAGATTCTGG - Intergenic
1098110746 12:67119111-67119133 TTGTTGTTGTTTAAATATTTTGG - Intergenic
1098439442 12:70502358-70502380 TTTATGTTCCTTGTAAATTCTGG + Intergenic
1098589653 12:72195610-72195632 TTTTTGTTCCTTATAGATTCTGG + Intronic
1099172821 12:79385739-79385761 TTGTTGTTGTTTTTTAATTCAGG + Intronic
1099506783 12:83487533-83487555 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1099820723 12:87705933-87705955 TTGAAGTTCCTTGTATATTCTGG - Intergenic
1099822883 12:87735990-87736012 TTGGAGTTCCTTGTAGATTCTGG - Intergenic
1099830659 12:87838497-87838519 TTGAAGTTCCTTGTAGATTCTGG - Intergenic
1099907154 12:88785061-88785083 TTGTTGTTGTTTTTGTTTTCTGG - Intergenic
1100026651 12:90137093-90137115 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1100321282 12:93495396-93495418 TTGTTGTTGTTTGTATTTTTTGG + Intronic
1100466638 12:94851643-94851665 TTTGAGTTTCTTGTATATTCTGG - Intergenic
1100580681 12:95937059-95937081 TTGTTTTTGTTTGTTTATTTTGG - Intronic
1100946813 12:99793941-99793963 TTTTTGTTCCTTATATATTCTGG - Intronic
1101067150 12:101033761-101033783 TTTAAGTTGCTTGTAAATTCTGG - Intronic
1101069360 12:101057733-101057755 TTTAAGTTGCTTGTAGATTCTGG + Intronic
1101267763 12:103108847-103108869 TTGTAGTTATTTATATATTCTGG - Intergenic
1101277616 12:103219530-103219552 TTTATGTTCCTTGTAGATTCTGG - Intergenic
1102216593 12:111166022-111166044 TTGTTGTTGTTTTTATAGACTGG + Intronic
1102443414 12:112981089-112981111 TTCACGTTCCTTGTATATTCTGG + Intronic
1102874744 12:116440937-116440959 TTGTGTTTTCTTGAATATTCAGG - Intergenic
1103533507 12:121619083-121619105 GTGTTTTTGCTTGTATGTTTAGG - Intergenic
1104255913 12:127138148-127138170 TTTATGTTCCTTGTAAATTCTGG + Intergenic
1104824298 12:131697707-131697729 TTGTTGTTGTTTGTTTGTTTTGG + Intergenic
1105073601 12:133253991-133254013 TTTTTGTTGACTGTATTTTCAGG + Intergenic
1105902744 13:24771147-24771169 TTGTTGTTGTTTGCTTTTTCTGG + Intronic
1106731329 13:32544389-32544411 TTTGTGTTCCTTGTATATTCTGG - Intergenic
1107208991 13:37829229-37829251 TAGTTGTTCTTTTTATATTCTGG - Intronic
1107297377 13:38924787-38924809 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1107764329 13:43717662-43717684 TTGTTTTTGCTTGTAGATTCTGG - Intronic
1107918344 13:45176502-45176524 TTGTAGTTCTTTATATATTCTGG + Intronic
1108299393 13:49059234-49059256 TAGTTTTAGCTTTTATATTCAGG - Intronic
1108785073 13:53890327-53890349 TTTTTGTTACCTGTATTTTCAGG + Intergenic
1108890645 13:55253983-55254005 TGGTTATTGCTTCTATTTTCTGG - Intergenic
1108893428 13:55293210-55293232 TTGTTGTTGTTTGCATTTTGAGG + Intergenic
1109035190 13:57249352-57249374 TTTTTGTTCCTTGGAAATTCTGG - Intergenic
1109212840 13:59554609-59554631 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1109298935 13:60570184-60570206 TTGTTTGAGCTTATATATTCTGG - Intronic
1109333774 13:60966100-60966122 CTGTGGTTGCTTTTATACTCTGG - Intergenic
1109458238 13:62622456-62622478 TTTGTGTTTCTTGTATATCCTGG - Intergenic
1109533381 13:63683614-63683636 TTTAAGTTCCTTGTATATTCTGG + Intergenic
1109606372 13:64703151-64703173 TTCCTGTTGTTTGTAGATTCTGG + Intergenic
1109696563 13:65968122-65968144 TTTTTGTTGCTTATATTTTAAGG + Intergenic
1109815988 13:67585546-67585568 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1109839173 13:67900714-67900736 TTTTAGTTCCTTGTAGATTCTGG - Intergenic
1109862755 13:68222416-68222438 TTGTTGTTGCTTTTTGATTAGGG + Intergenic
1109884829 13:68528407-68528429 TTTTAGTTCCTTGTAGATTCTGG - Intergenic
1109915407 13:68978812-68978834 TTTAAGTTCCTTGTATATTCTGG + Intergenic
1110016223 13:70407922-70407944 TAGTTGCTGCTTGTAGAGTCTGG - Intergenic
1110132470 13:72023875-72023897 TTGTTGTTGGTTATGGATTCAGG + Intergenic
1110228206 13:73141811-73141833 TTGTTTTTGCTTGGATTATCCGG - Intergenic
1110461792 13:75753279-75753301 TTGTTGTTCCTTATAAATTCTGG + Intronic
1111056599 13:82958418-82958440 TTTAAGTTGCTTGTAGATTCTGG - Intergenic
1111194648 13:84857999-84858021 TTTAAGTTCCTTGTATATTCTGG + Intergenic
1111227842 13:85298433-85298455 TTTCAGTTCCTTGTATATTCTGG + Intergenic
1111242998 13:85500010-85500032 TTGGTGTTGCCCGTATATTTAGG - Intergenic
1111254550 13:85649044-85649066 GAGTTGTTTCTTGTATACTCTGG - Intergenic
1111328932 13:86737036-86737058 TTTGTGTTCCTGGTATATTCTGG - Intergenic
1111460458 13:88535088-88535110 TTGGAGTTGCTTGTACATTATGG + Intergenic
1111471115 13:88683684-88683706 TTGGTGTTCATTGTAGATTCTGG - Intergenic
1111549913 13:89794840-89794862 TTTATGTTTCTTGTAGATTCTGG + Intergenic
1111552917 13:89839199-89839221 TTGAAGTTTCTTGTAGATTCTGG + Intergenic
1111854783 13:93623955-93623977 TTTGTGTTCCTTGAATATTCTGG + Intronic
1111857546 13:93657721-93657743 TTTATGTTCCTTATATATTCTGG - Intronic
1112140923 13:96641266-96641288 TTGTTGTTGCTTTTGTAATTGGG + Intronic
1112960102 13:105113544-105113566 TTGTTGTTCAGTGTATATTTTGG - Intergenic
1112986055 13:105451575-105451597 TTGTTGTTGTTTGTTTTTTGTGG + Intergenic
1113269762 13:108660818-108660840 TTGTTGTTGCCTGTGTACTTTGG + Intronic
1113384091 13:109832278-109832300 TTTAAGTTGCTTGTAAATTCTGG - Intergenic
1113637717 13:111931695-111931717 TATTTGTTCCTTGTAGATTCTGG + Intergenic
1114679116 14:24469179-24469201 TTTTAGTTCCTTGTATATTCTGG - Intergenic
1114686863 14:24541103-24541125 TTCATGTTGCTTATAGATTCTGG - Intergenic
1114707217 14:24739232-24739254 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1114793793 14:25689090-25689112 TTGTTGTTGTTTGTTTTTTTTGG + Intergenic
1114938903 14:27580739-27580761 TTGTTTTTGTTTTTAGATTCAGG - Intergenic
1115461840 14:33669882-33669904 TTGTTGTTGTTTGTTTTTTTGGG + Intronic
1115673400 14:35642361-35642383 TTTGAGTTCCTTGTATATTCTGG - Intronic
1115690479 14:35838741-35838763 TTTAAGTTGCTTGTAGATTCTGG + Intronic
1115783159 14:36793519-36793541 TTTTTTTTGGTTGTATTTTCTGG - Intronic
1115819807 14:37201838-37201860 TTGTTGTTGCTTTTAGAAACAGG + Intronic
1115823490 14:37237617-37237639 TTGTTGTTGTTTGTAGAGGCTGG + Intronic
1115830563 14:37335777-37335799 TTGTTATTGTTTGTATATTCTGG + Intronic
1115926740 14:38444232-38444254 TTGTTTTTGCTTGGCTATTCAGG + Intergenic
1116086611 14:40247249-40247271 TTTGAGTTTCTTGTATATTCTGG - Intergenic
1116209372 14:41913630-41913652 TGGTAGTTGTTTATATATTCAGG + Intergenic
1116355368 14:43921762-43921784 TTGAAGTTCCTTATATATTCTGG - Intergenic
1116450912 14:45064244-45064266 TGGTTTTTGCTTGTATTTCCTGG + Intronic
1116468753 14:45263244-45263266 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1116485852 14:45447329-45447351 GTTGTGTTCCTTGTATATTCTGG + Intergenic
1116497346 14:45577456-45577478 TTGTTTGAGCTTATATATTCTGG + Intergenic
1116690392 14:48099021-48099043 TTGAAGTTTTTTGTATATTCTGG + Intergenic
1117224819 14:53644961-53644983 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1117925678 14:60776829-60776851 TTGTTGTTGTTTGTTTGTTTTGG + Intronic
1118079906 14:62346927-62346949 TTATTGTTCCATGTATCTTCAGG + Intergenic
1118101070 14:62603223-62603245 TTGTTGTTGCTTTAATAATTTGG + Intergenic
1118140993 14:63082421-63082443 TTTGAGTTCCTTGTATATTCTGG - Intronic
1118607947 14:67516677-67516699 TTGTTGATCTTTGAATATTCTGG - Intronic
1118826128 14:69383503-69383525 TTTTTGTTCTTTGAATATTCAGG - Intronic
1119594296 14:75919740-75919762 TTGTTGTTGCTTGTACTTTTTGG - Intronic
1119792201 14:77361526-77361548 TTAGGATTGCTTGTATATTCAGG + Intronic
1120118762 14:80652464-80652486 TTTAAGTTGCTTGTAGATTCTGG - Intronic
1120446420 14:84602504-84602526 TTGTTGTTCCTTGTACATCAAGG + Intergenic
1120801020 14:88688556-88688578 TTGTTGTTGTTTGAATAGTAAGG + Intronic
1121400397 14:93671442-93671464 TTTGAGTTCCTTGTATATTCTGG - Intronic
1121504621 14:94467337-94467359 AAGTTCTTTCTTGTATATTCAGG + Exonic
1121891781 14:97601226-97601248 TTGTTGTTGCCTGTTTGTTTTGG - Intergenic
1122185641 14:99992473-99992495 TTGCTGTTGGTATTATATTCAGG + Intronic
1122398088 14:101449455-101449477 ATGTTGATGCATGTATTTTCCGG - Intergenic
1122454085 14:101836098-101836120 TTATTGTTGCTTGTGGATTGAGG - Intronic
1122992760 14:105246037-105246059 TTGGAGTTTTTTGTATATTCAGG - Intronic
1202917788 14_KI270723v1_random:952-974 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1202926837 14_KI270724v1_random:33633-33655 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1123863044 15:24487370-24487392 TTTGTGTTTCTTGTAGATTCTGG + Intergenic
1123877145 15:24634799-24634821 TTGTTTTTCTTTGTAGATTCTGG + Intergenic
1124146407 15:27129924-27129946 TTGTAGTTCTTTATATATTCTGG + Intronic
1124586508 15:31014633-31014655 TTGTTGTTGCTTTTATGGTGGGG + Intronic
1124924031 15:34053948-34053970 TTTATGTTCCTTGTAGATTCTGG - Intronic
1125648064 15:41290130-41290152 TTGTTGTTGTTTGTTTGTTTTGG + Intergenic
1125866238 15:43052370-43052392 TTTTTGTAGCTTTTATTTTCTGG - Intronic
1126015022 15:44342436-44342458 TTGTTGTTGTTTGTAGAGACAGG + Intronic
1126204163 15:46023924-46023946 TTGGAGTTCCTTGTAGATTCTGG + Intergenic
1126366662 15:47901666-47901688 TTCCTGTTGCTTGTATTATCTGG + Intergenic
1126609916 15:50518931-50518953 TTTGAGTTCCTTGTATATTCTGG - Intronic
1126908717 15:53396316-53396338 TTGATGTTGCTGGGATATTTAGG - Intergenic
1127091412 15:55471026-55471048 TTGTTGTTGTTTTTAGAGTCAGG + Intronic
1127143782 15:56003758-56003780 TTCTTTTTGTTTGTTTATTCTGG + Intergenic
1127341106 15:58045016-58045038 TTGAAGTTGTTTGTAGATTCTGG - Intronic
1127943177 15:63721860-63721882 TTGTTGTTGCTTGTTTTTTGAGG + Intronic
1128005521 15:64236417-64236439 TTTGAGTTCCTTGTATATTCTGG - Intronic
1128481277 15:68041727-68041749 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1128503638 15:68248921-68248943 TTTGAGTTCCTTGTATATTCTGG - Intronic
1129229721 15:74190402-74190424 TTGTTGTTGTTGGTTTTTTCGGG + Intronic
1129639556 15:77361138-77361160 ATGTTTGTCCTTGTATATTCTGG - Intronic
1130723497 15:86413744-86413766 TTTGTGTTCCTTGTAAATTCTGG + Intronic
1130758605 15:86793736-86793758 TTGTTGTTGAATGTATATTCTGG - Intronic
1130761063 15:86820412-86820434 TTTAAGTTCCTTGTATATTCTGG - Intronic
1131658513 15:94487336-94487358 TTTTTTTTGCCTGTATAATCAGG - Intergenic
1132255998 15:100376937-100376959 TTGTTTTAGCTTTTACATTCAGG + Intergenic
1132448057 15:101946136-101946158 TTTGTGTTACTTGTATATTCTGG + Intergenic
1132632317 16:924752-924774 TTGTAGTTGCTTGCTTTTTCTGG - Intronic
1133423545 16:5667598-5667620 TGTATCTTGCTTGTATATTCGGG + Intergenic
1133590968 16:7242995-7243017 TTTTTGTTACTTGGATTTTCAGG + Intronic
1134236680 16:12471698-12471720 TTGTTTTTGCTTTTAAATTCAGG + Intronic
1134591121 16:15454215-15454237 TAGATGTAGCTTGTATAATCTGG + Intronic
1135315091 16:21438104-21438126 TTGGTGTTCTTTGTAGATTCTGG - Intronic
1135368017 16:21870372-21870394 TTGGTGTTCTTTGTAGATTCTGG - Intronic
1135443800 16:22500777-22500799 TTGGTGTTCTTTGTAGATTCTGG + Intronic
1136325201 16:29518560-29518582 TTGGTGTTCTTTGTAGATTCTGG - Intergenic
1136439888 16:30258542-30258564 TTGGTGTTCTTTGTAGATTCTGG - Intergenic
1136603481 16:31314100-31314122 TTTATGTTCCTTGTAGATTCTGG + Intronic
1136603601 16:31315311-31315333 TTTTTGTTGCTTGTGCTTTCAGG + Intronic
1137939067 16:52664497-52664519 TTTGAGTTTCTTGTATATTCTGG - Intergenic
1138045047 16:53713306-53713328 TTGTTGTTGTTAGTTTATTATGG + Intronic
1138072738 16:54009410-54009432 GTTTTGTTGCTTTTAAATTCAGG - Intronic
1138144993 16:54600781-54600803 TTTTTTTTTTTTGTATATTCTGG + Intergenic
1138753251 16:59450021-59450043 TTTTTTTTGCTTGTGTCTTCAGG + Intergenic
1138755739 16:59482285-59482307 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1138775734 16:59721927-59721949 TTTTTGTTGCTTTTATAATTAGG + Intronic
1138929329 16:61633235-61633257 TTGTTGTTGCTTTTAGAGACAGG + Intergenic
1139170136 16:64620233-64620255 TTTGTGTTCCTTGTAGATTCTGG + Intergenic
1139886388 16:70210841-70210863 TTGGTGTTCTTTGTAGATTCTGG - Intergenic
1139976040 16:70811248-70811270 TTGTTGTTGTTTGTAGAAACAGG - Intronic
1140543234 16:75779691-75779713 TTCTAGTTCCTTATATATTCTGG - Intergenic
1140954771 16:79852414-79852436 TTGAAGTTACTTGTAAATTCTGG + Intergenic
1140992284 16:80224953-80224975 TTGGTGTTAATTGTAGATTCTGG - Intergenic
1141253169 16:82377418-82377440 TTTTAGTTCCTTGTAGATTCTGG + Intergenic
1141902503 16:87001566-87001588 GTGTTCTTTATTGTATATTCTGG - Intergenic
1142166821 16:88595436-88595458 TTATTGTTGCTTCTATTTTCTGG + Intronic
1143761780 17:9109984-9110006 TTGGAGTTCTTTGTATATTCTGG + Intronic
1144132774 17:12264266-12264288 TTGTTGTTGTTTGTTTTTTTGGG + Intergenic
1144817128 17:18042355-18042377 TTGTTGTTGTTTGTCTATTCTGG + Intronic
1145049666 17:19649200-19649222 TTGTTTTTGCTTTTACATTTCGG + Intronic
1146298031 17:31665785-31665807 TTTTTGTTCTTTGTAGATTCTGG + Intergenic
1148234404 17:45958408-45958430 TTCTTTTTGCTTGTCTGTTCAGG - Intronic
1148261934 17:46192362-46192384 TTTTTGTTGCCTGTAAATTCAGG - Intronic
1148940766 17:51209285-51209307 TTGTTGTTACCTGTAAATTATGG - Intronic
1149229408 17:54515835-54515857 TAGTTGTTACTCGTCTATTCAGG + Intergenic
1149502960 17:57169035-57169057 TTTTTTTTTCTTCTATATTCTGG + Intergenic
1149923933 17:60683863-60683885 TTGTTGTTGTTTGTTTTTTGGGG - Intronic
1150169809 17:62981561-62981583 TTGTTGTTGACTGTATCTCCTGG + Intergenic
1150428426 17:65096015-65096037 TTGAAGTTCCTTGTAAATTCTGG - Intergenic
1150522159 17:65879914-65879936 TTGTTGTTTATTGTCTTTTCTGG - Intronic
1150539337 17:66080279-66080301 AAGTTGTTCCTTGTAGATTCTGG - Intronic
1150800815 17:68281211-68281233 TTTGAGTTCCTTGTATATTCTGG - Intronic
1151062249 17:71109189-71109211 CTCTTGTTGCTTGTATATTATGG + Intergenic
1152291944 17:79444848-79444870 TTGTAATTCCTTATATATTCTGG - Intronic
1153015408 18:578586-578608 TTGTTGTTGTTTGTTTTTTTGGG + Intergenic
1153395576 18:4616711-4616733 TTGTTTTTCTTTGTAGATTCTGG + Intergenic
1153437653 18:5085000-5085022 TTGTTGTTGTTTGTTTTTTGAGG - Intergenic
1153556584 18:6321349-6321371 TTTGTGTTCCTTGTAGATTCTGG - Intronic
1153703344 18:7718682-7718704 TTGGAGTTCCTTGTAGATTCTGG - Intronic
1153920823 18:9788160-9788182 TTTGAGTTGCTTGTATATTCTGG - Intronic
1154944891 18:21152180-21152202 TTCGAGTTCCTTGTATATTCTGG + Intergenic
1155075783 18:22353319-22353341 TTTTTGTTCCTTTTATATTCTGG + Intergenic
1155124695 18:22861068-22861090 TTTGAGTTCCTTGTATATTCTGG - Intronic
1155448172 18:25934719-25934741 TTTGAGTTTCTTGTATATTCTGG + Intergenic
1155813199 18:30265972-30265994 TTTGTGTTTCTTGTATAGTCTGG - Intergenic
1156025489 18:32649284-32649306 TTGTTTGAGCTTATATATTCTGG + Intergenic
1156735440 18:40252693-40252715 TTGTTGTTGTTTTTATAAACTGG + Intergenic
1156937314 18:42725892-42725914 TTGAAGTTCCTTGTAGATTCTGG - Intergenic
1157821446 18:50774033-50774055 TTTTAATTCCTTGTATATTCTGG - Intergenic
1157890211 18:51408421-51408443 TTTAAGTTCCTTGTATATTCTGG + Intergenic
1158798974 18:60883459-60883481 TTGTTTTTGTTTGTTTGTTCTGG + Intergenic
1158811712 18:61045860-61045882 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1159263188 18:66043049-66043071 TTTTAGTTCCTTGTAGATTCTGG + Intergenic
1159328599 18:66957391-66957413 TAGTTTTAGCTTGTATATTTAGG - Intergenic
1159434179 18:68394700-68394722 TTCTTGCTTCTTGCATATTCTGG + Intergenic
1159503171 18:69299655-69299677 TTTGAGTTTCTTGTATATTCTGG + Intergenic
1159730715 18:72023897-72023919 TTTTATTTCCTTGTATATTCTGG + Intergenic
1160184412 18:76663952-76663974 TTTAAGTTGCTTGTAGATTCTGG + Intergenic
1160275524 18:77430099-77430121 TTGAAGTTCCTTGTAGATTCTGG - Intergenic
1160417711 18:78722968-78722990 TTGTTTTTGTTTTTAAATTCAGG + Intergenic
1160637214 19:86411-86433 TTTGTGTTACTTGTATATTCTGG - Intergenic
1161228695 19:3161356-3161378 CTATGGTTGCTTGTATATTGAGG - Intronic
1162615148 19:11793608-11793630 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1164046546 19:21547748-21547770 TTTAAGTTCCTTGTATATTCTGG + Intronic
1164395259 19:27857927-27857949 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1164663049 19:29995438-29995460 TTGTAGTTCTTTATATATTCTGG + Intronic
1165260284 19:34609195-34609217 TTTGAGTTCCTTGTATATTCTGG + Intronic
1165287786 19:34857161-34857183 TTTGTGTTCCTTGTATACTCTGG - Intergenic
1165599328 19:37039899-37039921 TTGTTGTTGTTTGTAGAGACAGG + Intronic
1168182174 19:54669375-54669397 CTTTTGTTGCTTGTGTTTTCAGG + Exonic
1168557995 19:57359605-57359627 TTGCTGTTGCTTGTGAATTGTGG - Exonic
924968747 2:103400-103422 TTTCAGTTTCTTGTATATTCTGG + Intergenic
925093695 2:1176616-1176638 TTTTAGTTCCTTGTAGATTCTGG - Intronic
925250159 2:2427094-2427116 TTTTTGTTGCTTGATTGTTCAGG - Intergenic
926261455 2:11267527-11267549 TTGTTGTTGTTTGTGTTTTTTGG - Intronic
926451789 2:13012886-13012908 TTTGTGTTCCTTGTCTATTCCGG + Intergenic
926593992 2:14770145-14770167 TTGTTGGTGGTTGTTTCTTCAGG + Intergenic
926917244 2:17904330-17904352 TTGGAGTTCTTTGTATATTCTGG + Intronic
926963879 2:18388307-18388329 TTGTTGTTGTTTGTTTGTTTTGG + Intergenic
927283628 2:21334187-21334209 TTGTTGAGCCTTGTATATTCAGG + Intergenic
927619589 2:24638875-24638897 TTTGAGTTCCTTGTATATTCTGG + Intronic
928752831 2:34490855-34490877 TTTGAGTTCCTTGTATATTCTGG - Intergenic
929197508 2:39201087-39201109 TTTGAGTTGCTTGTAGATTCTGG - Intronic
929203361 2:39262060-39262082 TTTTTGTTGCTTTTATAAACTGG + Intronic
929333087 2:40708364-40708386 TTAATGTTCCTTGTACATTCTGG + Intergenic
929341167 2:40819545-40819567 TTGTTGTTGTTTTAACATTCAGG - Intergenic
929913145 2:46110222-46110244 TTCATTTTGCTTCTATATTCTGG + Intronic
930123628 2:47779940-47779962 TTGTTGTTGTTTGTTTTTTTGGG - Intronic
930440358 2:51396742-51396764 TTTATGTTCCTTGTAGATTCTGG - Intergenic
930456953 2:51617351-51617373 TTGAAGTTGCTTATAGATTCCGG - Intergenic
930617946 2:53613669-53613691 TTTGAGTTCCTTGTATATTCTGG + Intronic
930764967 2:55076202-55076224 TTTGTGTTCCTTGTAGATTCTGG - Intronic
930906890 2:56580302-56580324 TTTGTGTTTCTTATATATTCTGG - Intergenic
930926259 2:56821820-56821842 TTGAAGTTTCTTGTAGATTCTGG - Intergenic
931167306 2:59761875-59761897 TTGTTGTTGTTTGTTTGTTTAGG + Intergenic
931211148 2:60196514-60196536 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
931575474 2:63713959-63713981 TTGTTGTTCCAAGTATATTTTGG + Intronic
931765048 2:65447679-65447701 TTTGAGTTCCTTGTATATTCTGG + Intergenic
932062440 2:68520186-68520208 TTGTTTTTTCTTGTAGATTCTGG + Intronic
932065147 2:68549246-68549268 ATTTTGTTGATTGTATTTTCAGG + Intronic
932218309 2:69981554-69981576 TTGTTGTTGTTTGTTTGTTTTGG + Intergenic
932423852 2:71616913-71616935 TTGTTGTTGTTTTTTTATTAAGG + Intronic
932602693 2:73139471-73139493 TTGTTGTTGTTTCTATATACAGG + Intronic
932717794 2:74115225-74115247 TTTGAGTTCCTTGTATATTCTGG - Intergenic
932977330 2:76619253-76619275 GTGGTGTTCCTTGTATATTTTGG + Intergenic
933109628 2:78381244-78381266 TTGTTTTTCTTTGTAGATTCTGG - Intergenic
933172459 2:79138965-79138987 TTGTTGTTGTTTGTTTGTTTTGG + Intergenic
933244875 2:79963947-79963969 TTGTTATTGCTGGTAATTTCAGG + Intronic
933324693 2:80820398-80820420 TTTATGTTTCTTGTAGATTCTGG - Intergenic
933345619 2:81081721-81081743 TTTTAGTTTCTTTTATATTCTGG - Intergenic
933593764 2:84261759-84261781 TCGGAGTTCCTTGTATATTCTGG - Intergenic
933617708 2:84499913-84499935 TTTTAGTTCCTTATATATTCCGG + Intergenic
933619491 2:84521344-84521366 TGTTTGTTTCTTGTAGATTCTGG + Intronic
933903766 2:86869059-86869081 TTCTAGTTGCTTGTGTAATCTGG - Intergenic
933986844 2:87599155-87599177 TTGTTGTTTTTTTTTTATTCTGG + Intergenic
934043889 2:88154827-88154849 TTTGAGTTCCTTGTATATTCTGG - Intergenic
935458630 2:103301071-103301093 TTTAAGTTGCTTGTAGATTCAGG + Intergenic
935465373 2:103390100-103390122 TTTTTGTTGTTTGTTTATTTTGG + Intergenic
935486479 2:103661952-103661974 TTTGAGTTTCTTGTATATTCTGG - Intergenic
935646496 2:105340128-105340150 TTGTTGTTCCTGGTATATGATGG - Intronic
935864492 2:107370982-107371004 TTTGAGTTTCTTGTATATTCTGG + Intergenic
936766435 2:115854637-115854659 TTTGAGTTCCTTGTATATTCTGG + Intergenic
936999480 2:118452176-118452198 TTTAAGTTCCTTGTATATTCTGG + Intergenic
937143690 2:119624139-119624161 TTTGAGTTCCTTGTATATTCTGG - Intronic
937449315 2:121988446-121988468 TTGGAGTTTCTTGTATATTTGGG - Intergenic
937526558 2:122777326-122777348 TTTTAGTTCCTTGTAGATTCAGG - Intergenic
937585457 2:123542574-123542596 TTTTAGTTCCTTGTAGATTCTGG - Intergenic
938600466 2:132833241-132833263 TTTGAGTTTCTTGTATATTCGGG + Intronic
938693857 2:133816960-133816982 TTTGAGTTTCTTGTATATTCTGG - Intergenic
938870188 2:135467350-135467372 TTGTTGTTTCAGGTATATCCGGG + Intronic
939062830 2:137444888-137444910 TTGGAGTTCCTTTTATATTCTGG - Intronic
939180854 2:138801201-138801223 TTTAAGTTCCTTGTATATTCTGG - Intergenic
939371274 2:141304135-141304157 TTTGAGTTCCTTGTATATTCTGG + Intronic
939478151 2:142713120-142713142 TTGAAGTTCCTTGTAGATTCTGG - Intergenic
940050457 2:149457087-149457109 TTCTTGTTGGATGTATATTGAGG + Intronic
940104204 2:150079754-150079776 TTTGAGTTACTTGTATATTCTGG - Intergenic
940125864 2:150323502-150323524 TTTGAGTTCCTTGTATATTCTGG + Intergenic
940470921 2:154099288-154099310 TTTTAGTTGCTTGGAAATTCTGG + Intronic
940560626 2:155291342-155291364 GTTTTGTTCCTTGTAAATTCTGG + Intergenic
940684705 2:156832422-156832444 TTTATGTTCCTTATATATTCTGG - Intergenic
940965003 2:159827229-159827251 TTGAAGTTTCTTGTAGATTCTGG - Intronic
941148751 2:161887675-161887697 TTGAAGTTCCTTGTAGATTCTGG + Intronic
941229248 2:162888975-162888997 TTTTTTTTGCTTGTATGATCAGG + Intergenic
941894794 2:170618517-170618539 TCGTTGTTGCATGCATCTTCAGG + Intronic
942056301 2:172186518-172186540 TTGTAATTCCTTATATATTCTGG + Intergenic
942375805 2:175335914-175335936 TTTGTGTTCCTTGTATATTCCGG + Intergenic
942977846 2:182040526-182040548 TTTGAGTTGCTTGTAGATTCTGG + Intronic
943212976 2:184991619-184991641 TTTGTGTTTCTTTTATATTCTGG - Intergenic
943281309 2:185937167-185937189 TTTGAGTTTCTTGTATATTCTGG + Intergenic
943390200 2:187257030-187257052 TTATTGTTGATTGAATAATCTGG - Intergenic
943413779 2:187572733-187572755 TTTATGTTCCTTGTAGATTCTGG + Intergenic
943490687 2:188552041-188552063 TTTGAGTTCCTTGTATATTCTGG + Intronic
943504831 2:188741869-188741891 TTTATGTTCCTTGTAGATTCTGG + Intronic
943879105 2:193116066-193116088 TTCTTATTTCTTCTATATTCTGG - Intergenic
943918529 2:193670892-193670914 TTCTTGTGGCTTATATTTTCTGG - Intergenic
943986099 2:194620901-194620923 TTGTTATTGTTTTTATATTAGGG + Intergenic
944195498 2:197049051-197049073 TTGATGTTCTTTGTAGATTCTGG + Intronic
944222293 2:197314528-197314550 TTGTTGTTGGTTTTCTATTCTGG - Intergenic
944949987 2:204737451-204737473 TTTGTGTTCCTTGTAAATTCTGG + Intronic
945031418 2:205667421-205667443 TTTGAGTTCCTTGTATATTCTGG + Intergenic
945171407 2:207000620-207000642 TTGTTGTTGTTTGTAAATTATGG - Intergenic
945363496 2:208922095-208922117 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
945481051 2:210346157-210346179 TTTATGTTCCTTGTAGATTCTGG + Intergenic
945486443 2:210402194-210402216 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
945521196 2:210829568-210829590 TTTTTGTTGTTTGTATGTTCTGG + Intergenic
945627938 2:212234845-212234867 TTGTTTTTCTTTGTAGATTCTGG + Intronic
945865996 2:215176509-215176531 TTTTAGTTCCTTGTATATTACGG + Intergenic
946157100 2:217814185-217814207 TTTTTGTTTTTTGTAGATTCAGG + Intronic
946638735 2:221759749-221759771 TTGTAGTTTCTTATAAATTCTGG + Intergenic
946783141 2:223213657-223213679 TTATTATTACTTGTATATTAGGG + Intergenic
946910830 2:224458926-224458948 TTGTTGTTGCTTTTATTGTTTGG + Intergenic
947057174 2:226118378-226118400 TTGTTTTTGCTTGTTTGTTTTGG - Intergenic
947146926 2:227076759-227076781 TTTAAGTTCCTTGTATATTCTGG - Intronic
947532753 2:230923218-230923240 TTCTTGTTGCTTGTGTTCTCTGG - Intronic
948088647 2:235271992-235272014 TTGTTTTTGCTTGGACATTTTGG - Intergenic
948441375 2:237992569-237992591 TATTTGCTGCTTGTATATACAGG + Intronic
1168921590 20:1541509-1541531 TTCATGTTCCTTGTAGATTCTGG + Intronic
1169098848 20:2928132-2928154 TTGTTGTTGTTTGTTTGTTTTGG + Intronic
1169534380 20:6522222-6522244 TTATTGTAGCTAGTATATTTAGG - Intergenic
1170288381 20:14737820-14737842 TTTTAGTTCCTTGTAGATTCTGG + Intronic
1170719999 20:18868293-18868315 TGTTTGTTTCTTGTAGATTCTGG + Intergenic
1170849432 20:19990969-19990991 TTGTTGTTTCCTGTAGATGCAGG + Intronic
1170954732 20:20968827-20968849 TTATTTTTGCTTTTTTATTCTGG + Intergenic
1171276736 20:23862618-23862640 TTGTAGTTCCTTGAAGATTCTGG + Intergenic
1171537114 20:25903720-25903742 TAGTTGTTTCTTATATATTTTGG + Intergenic
1171853944 20:30327884-30327906 TTGTTGTTGTTTGTTTTTTTGGG - Intergenic
1173692292 20:44971043-44971065 TTGTTGTTCTTTGTAGTTTCAGG + Intronic
1173767359 20:45624959-45624981 TTTGAGTTTCTTGTATATTCTGG + Intronic
1173804880 20:45918006-45918028 TTGTTGTTGTTTGTCTTTTGAGG + Intergenic
1173824577 20:46039800-46039822 TTGTTGTTGGTTTTTTATTGTGG - Intronic
1174241510 20:49139343-49139365 TTGTAGTTCTTTATATATTCTGG - Intronic
1174927943 20:54781694-54781716 TTGTAGTTCTTTATATATTCAGG + Intergenic
1175617666 20:60415212-60415234 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1177042230 21:16128356-16128378 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
1177092370 21:16785077-16785099 TTTAAGTTTCTTGTATATTCTGG - Intergenic
1177101771 21:16906920-16906942 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1177367808 21:20160222-20160244 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1177408486 21:20700178-20700200 TAGTTTTAGCTTGTATATTTAGG - Intergenic
1177424552 21:20905517-20905539 TTATTGTTGTTTGTAGATTCAGG - Intergenic
1177973707 21:27822030-27822052 TTTTAGTTGCTTGTAGATTCTGG - Intergenic
1178832288 21:36066182-36066204 TTGTTTTTGTTTTTAGATTCGGG + Intronic
1178973969 21:37206358-37206380 TTGTAGTTATTTGTACATTCTGG - Intergenic
1179240451 21:39585642-39585664 TTTGAGTTTCTTGTATATTCTGG - Intronic
1179260398 21:39752871-39752893 TTTTAGTTCCTTGTAGATTCTGG + Intronic
1179462148 21:41543561-41543583 TTGTGGTTGCTAATATATTTGGG - Intergenic
1179473577 21:41628829-41628851 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1180562798 22:16634365-16634387 TTGGTGTTCTTTGTAGATTCTGG + Intergenic
1181413392 22:22741746-22741768 TTGGTATTGCTTGGCTATTCAGG - Intronic
1183878427 22:40804597-40804619 TGTGAGTTGCTTGTATATTCTGG + Intronic
1184258243 22:43299341-43299363 TTGTTGTTGCTTTTGCATTTTGG - Intronic
1184300699 22:43557487-43557509 TTGTGGTTACCTGTCTATTCAGG - Intronic
949095233 3:77745-77767 TTGTTGTTGTTTGTTTGTTTTGG + Intergenic
949168205 3:966276-966298 GTTTTGTTGCTTGTATGTTGGGG - Intergenic
949378370 3:3415886-3415908 TTTGTGTTCCTTGTAGATTCTGG - Intergenic
949384229 3:3481853-3481875 TTGGTGTTCATTGTAGATTCTGG - Intergenic
949667991 3:6363825-6363847 TTTAAGTTCCTTGTATATTCTGG - Intergenic
949687437 3:6592044-6592066 TTGGTGTTCATTGTAGATTCTGG - Intergenic
950052098 3:10000023-10000045 TTGTTGTTGTTTTTATTTTTTGG + Intronic
950822926 3:15781025-15781047 TTTTTGTTGCTTGTGCTTTCAGG - Intronic
951197633 3:19841776-19841798 TTTAAGTTCCTTGTATATTCTGG + Intergenic
951316883 3:21197982-21198004 CTTTAGTTCCTTGTATATTCTGG + Intergenic
951492398 3:23286050-23286072 TTTTAGTTCCTTATATATTCTGG + Intronic
951675740 3:25239173-25239195 TTTGAGTTCCTTGTATATTCTGG + Intronic
951929341 3:27946451-27946473 TTTTAGTTCCTTATATATTCTGG + Intergenic
951947989 3:28164077-28164099 TTTGAGTTCCTTGTATATTCTGG - Intergenic
952016750 3:28965937-28965959 TTTGAGTTCCTTGTATATTCTGG + Intergenic
952194047 3:31053868-31053890 TTGTTGTAACTTCTATAATCAGG - Intergenic
952345187 3:32477206-32477228 TTTGAGTTTCTTGTATATTCTGG - Intronic
952460686 3:33522394-33522416 TTATTTTTGCTTGTTGATTCTGG - Intronic
952941372 3:38447039-38447061 TTTGAGTTCCTTGTATATTCTGG - Intergenic
953012121 3:39036623-39036645 TTTGTGTTCCTTATATATTCTGG - Intergenic
953513083 3:43563093-43563115 TTTGAGTTCCTTGTATATTCTGG - Intronic
953592804 3:44276073-44276095 TTTGAGTTCCTTGTATATTCTGG + Intronic
954528285 3:51293729-51293751 TTGAGGTTCCTTGTATATTTTGG - Intronic
954951015 3:54473653-54473675 TTTATGTTCCTTGTAGATTCTGG - Intronic
955576920 3:60375676-60375698 TTGTAGTTACTTTCATATTCTGG + Intronic
955761326 3:62286508-62286530 TTGTGATTCCTTGTATAGTCAGG - Intronic
956006336 3:64782404-64782426 TTTATGTTCCTTGTAGATTCTGG - Intergenic
956298451 3:67740541-67740563 TTTGAGTTCCTTGTATATTCTGG + Intergenic
956940675 3:74157832-74157854 TTGGAGTTCATTGTATATTCTGG + Intergenic
957083758 3:75660803-75660825 TTTGAGTTCCTTGTATATTCTGG + Intergenic
957433659 3:80147213-80147235 TTGAAGTTCCTTGTAAATTCTGG + Intergenic
957475335 3:80715012-80715034 TTTAAGTTGCTTGTAGATTCTGG - Intergenic
957597057 3:82280032-82280054 TTTAAGTTCCTTGTATATTCTGG + Intergenic
957941452 3:87010233-87010255 TTGTTGTTGTTTGTTTTTTGTGG + Intergenic
957963247 3:87288400-87288422 TTCAAGTTCCTTGTATATTCTGG - Intergenic
958046782 3:88294492-88294514 TTTAAGTTGCTTGTAAATTCTGG + Intergenic
958054738 3:88394807-88394829 TAGTTGTTGTTTATATATTCTGG + Intergenic
958481502 3:94650838-94650860 TTGTTGTTGTATGCATTTTCAGG - Intergenic
958484643 3:94688956-94688978 TTTGTATTTCTTGTATATTCTGG - Intergenic
958533943 3:95371190-95371212 TTTGAGTTCCTTGTATATTCTGG + Intergenic
958695204 3:97518868-97518890 TTTGAGTTCCTTGTATATTCTGG + Intronic
959131247 3:102358954-102358976 TTGTTGTTGTTTGTAATTTTAGG + Intronic
959453175 3:106528014-106528036 TTTCAGTTGCTTGTAAATTCTGG - Intergenic
959492731 3:107010904-107010926 TTTGGGTTCCTTGTATATTCTGG - Intergenic
959706641 3:109344135-109344157 TTTTGGGTCCTTGTATATTCTGG + Intergenic
959865491 3:111264867-111264889 TTTTTGTTGTTGTTATATTCTGG - Intronic
959876141 3:111384478-111384500 TTTATGTTTCTTGTAGATTCTGG - Intronic
960517002 3:118613378-118613400 TTTTAGTTCCTTGTAGATTCTGG - Intergenic
960551388 3:118979800-118979822 TTACTGTTGATTGCATATTCTGG - Intronic
960581637 3:119283939-119283961 TTTGAGTTCCTTGTATATTCTGG + Intergenic
960679633 3:120233897-120233919 TTGAAGTTCCTTGTAGATTCTGG + Intronic
961953630 3:130776584-130776606 TTTCTGTTTCTTGTATATTCTGG - Intergenic
961955525 3:130798897-130798919 TTTGAGTTCCTTGTATATTCTGG - Intergenic
962217297 3:133533698-133533720 TTGTTCTTGCTGGTATAGACAGG + Intergenic
962984929 3:140527201-140527223 TTTATGTTCCTTGTAGATTCTGG - Intronic
963449254 3:145457129-145457151 CTGTTGTGGCTTGTGTATTCAGG + Intergenic
963527048 3:146428359-146428381 TTGTTTCTGCTTGTGGATTCTGG - Intronic
963685209 3:148425013-148425035 TTGTTGTTCTTTATATATTCTGG - Intergenic
963830381 3:150001394-150001416 TTTGAGTTCCTTGTATATTCTGG - Intronic
963960659 3:151305419-151305441 TTGTTGTTGGTTGTAAAATGAGG + Intronic
963996167 3:151711512-151711534 TTTGAGTTCCTTGTATATTCTGG - Intergenic
964232956 3:154492037-154492059 TTCTTGTTCCTTGTAGATTCTGG - Intergenic
964241030 3:154594956-154594978 TTGGTGTTCATTGTAGATTCTGG + Intergenic
964294203 3:155215510-155215532 TTTTTTTTGCTTTTAAATTCAGG - Intergenic
964298953 3:155266396-155266418 TTTGTGTTCCTTGTAGATTCTGG - Intergenic
964431189 3:156607670-156607692 TAGTAGTTCCTTATATATTCTGG + Intergenic
964537766 3:157743460-157743482 TTGGTGTTCCTTGTAGATTCTGG + Intergenic
964736096 3:159919689-159919711 TAGGAGTTCCTTGTATATTCTGG - Intergenic
965041303 3:163510488-163510510 TTATTTTTGTTTGTATATTTTGG + Intergenic
965254990 3:166395332-166395354 TTTATGTTCCTTGTAGATTCTGG + Intergenic
966361505 3:179134850-179134872 TTTGAGTTCCTTGTATATTCTGG - Intergenic
966537463 3:181050790-181050812 TTGTTGTTGTTTGTTTGTTGGGG + Intergenic
966694200 3:182772814-182772836 TTTGAGTTCCTTGTATATTCTGG + Intergenic
966704273 3:182894050-182894072 TTTGAGTTGCTTGTAGATTCTGG + Intronic
967701703 3:192600566-192600588 TTTGAGTTTCTTGTATATTCTGG - Intronic
968256178 3:197274740-197274762 TTGTTGCTCCTTATATATTCTGG - Intronic
969372034 4:6738080-6738102 TGGTTGTTCTTTATATATTCTGG + Intergenic
969808599 4:9630315-9630337 TTGGTGTTCATTGTAGATTCTGG - Intergenic
970058093 4:11998640-11998662 TTGTTGTTGCCTGTGTTTTGGGG - Intergenic
970539484 4:17062925-17062947 TTGTAGTTGCTTGTAGATTCTGG - Intergenic
971023823 4:22568035-22568057 TTTGAGTTCCTTGTATATTCTGG + Intergenic
971061208 4:22972490-22972512 TTTGAGTTTCTTGTATATTCTGG + Intergenic
971614912 4:28776368-28776390 TTGTTGTTGCCTGTGTATGGGGG - Intergenic
971669674 4:29541675-29541697 ATGTTCTTGCTGGTATATTTTGG - Intergenic
971873010 4:32268554-32268576 TTATTTTTTCTTATATATTCAGG - Intergenic
971933199 4:33112940-33112962 TTGAAGTTCCTTGTAGATTCTGG - Intergenic
972000495 4:34025816-34025838 TGTTTGTTTCTTGTAGATTCTGG + Intergenic
972130049 4:35821446-35821468 TTGTTGTTGTTGTTCTATTCTGG - Intergenic
972807093 4:42540061-42540083 TTTCAGTTTCTTGTATATTCTGG - Intronic
972845037 4:42977676-42977698 TTTGGGTTCCTTGTATATTCTGG + Intronic
972853971 4:43083287-43083309 TTGTTGTTTCTTATAGATTTTGG + Intergenic
973144975 4:46813812-46813834 TTTGTGTTTCTTTTATATTCTGG - Intronic
973581104 4:52345174-52345196 TTGTTCTTCCTTTTATTTTCAGG - Intergenic
973596373 4:52494676-52494698 TTTGGGTTCCTTGTATATTCTGG - Intergenic
973761111 4:54116634-54116656 TTGTAGTTGTTTATATATTCTGG + Intronic
973944075 4:55939839-55939861 TTGGTATTACTTGTATATTGAGG + Intergenic
974224866 4:59027658-59027680 TTTTGGTTACTTGTAGATTCTGG + Intergenic
974292856 4:59956183-59956205 TAGTAGTTCTTTGTATATTCAGG - Intergenic
974302503 4:60086313-60086335 TTTAAGTTGCTTGTAGATTCTGG - Intergenic
974589976 4:63934217-63934239 TTTGAGTTTCTTGTATATTCTGG - Intergenic
974712204 4:65612747-65612769 TTTCTGTTCCTTGTAGATTCTGG + Intronic
974760840 4:66271499-66271521 TTTATGTTCCTTGTAAATTCTGG - Intergenic
974773988 4:66456281-66456303 TTGGAGTTTCTTATATATTCTGG - Intergenic
974784561 4:66601426-66601448 TTTGAGTTCCTTGTATATTCTGG - Intergenic
975410805 4:74046840-74046862 TTTTAGTTGCTTGAATATTCTGG + Intergenic
975520564 4:75296520-75296542 TTGGAGTTCATTGTATATTCTGG + Intergenic
976444322 4:85112917-85112939 ATTTTGTTGCTTGAATATTTAGG + Intergenic
976464045 4:85347464-85347486 TTTTTCTTCCTTATATATTCTGG + Intergenic
976574106 4:86649096-86649118 TTTGTGTTCCTTATATATTCTGG + Intronic
976949174 4:90808510-90808532 TTTGAGTTGCTTGTAGATTCTGG - Intronic
977013377 4:91661230-91661252 TTTTATTTCCTTGTATATTCTGG + Intergenic
977056380 4:92198175-92198197 TTCTTGTTTCCTATATATTCTGG + Intergenic
977398397 4:96500180-96500202 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
977539928 4:98304564-98304586 TTGTAGTTCCTTGTAAATTCTGG + Intronic
977818607 4:101444922-101444944 TTTATGTTCCTTGTAGATTCTGG - Intronic
978175498 4:105727093-105727115 TTTTTTTTTTTTGTATATTCAGG + Intronic
978323954 4:107529864-107529886 TTTGAGTTCCTTGTATATTCTGG - Intergenic
978422779 4:108551660-108551682 TTTGAGTTCCTTGTATATTCTGG - Intergenic
978544699 4:109858447-109858469 TCGTTGTTGCATGCATCTTCAGG + Intronic
978613838 4:110573420-110573442 TTGGAGTTGCTTGTATATTCTGG - Intergenic
978874643 4:113624662-113624684 TTACTGTGGCTAGTATATTCTGG + Intronic
978917111 4:114140673-114140695 TTGGAGTTCCTTGTACATTCTGG + Intergenic
979499280 4:121420163-121420185 TTTTACTTCCTTGTATATTCTGG + Intergenic
979539578 4:121866089-121866111 TTTGAGTTCCTTGTATATTCTGG + Intronic
980173319 4:129315390-129315412 TTTTAGTTCCTTGTAAATTCTGG - Intergenic
980231182 4:130048472-130048494 TTGTTGGTTCTTTTATATGCTGG + Intergenic
980276471 4:130657602-130657624 TTGGAGTTTCTTGTAGATTCAGG - Intergenic
980305513 4:131055494-131055516 TTGAAGTTACTTGTAGATTCTGG - Intergenic
980527258 4:134007026-134007048 TTTATGCTGCTTGTATATTTTGG - Intergenic
980627595 4:135393411-135393433 TTGTTCTAGATTTTATATTCAGG - Intergenic
980635999 4:135504031-135504053 TAGTTGTTCTTTGTATATTTTGG - Intergenic
980786928 4:137567988-137568010 TTTCAGTTGCTTGTAAATTCTGG + Intergenic
981637133 4:146893803-146893825 TTGGAGTTCCTTGTAGATTCTGG - Intronic
981858834 4:149329574-149329596 TTTTTGTTGCTTATATTTTGAGG + Intergenic
982323018 4:154099896-154099918 TTTGAGTTCCTTGTATATTCTGG + Intergenic
982656323 4:158154131-158154153 TTTGAGTTGCTTGTAGATTCTGG - Intronic
982934293 4:161451623-161451645 ATGATGTTGCTGGGATATTCAGG + Intronic
982940343 4:161543868-161543890 TTGTTGTTGCTTGTGCTTTGGGG - Intronic
982999499 4:162396090-162396112 TTGGAGTTGCTTGTAAATTCTGG - Intergenic
983251670 4:165352940-165352962 ATTTTGTTGCTTGTATTTTTGGG - Intergenic
983396005 4:167196242-167196264 TTGTACTTGCTTGTATTTTGGGG + Intronic
983740481 4:171125361-171125383 TTTTAGTTCCTTGTATATTTTGG + Intergenic
983793197 4:171824971-171824993 TCGTTGTTCATTGCATATTCTGG - Intronic
984394488 4:179177547-179177569 TTTGAGTTCCTTGTATATTCTGG + Intergenic
984616284 4:181902226-181902248 TTTAAGTTCCTTGTATATTCTGG + Intergenic
984704267 4:182836350-182836372 TTGTTGTTGTTTGTAGAGACGGG - Intergenic
985326009 4:188771046-188771068 TTTGAGTTTCTTGTATATTCTGG + Intergenic
985394036 4:189522718-189522740 TTTAAGTTTCTTGTATATTCTGG + Intergenic
986613315 5:9591517-9591539 TTGTAGTTCTTTATATATTCTGG - Intergenic
986810762 5:11356798-11356820 TTGCAGTTTCTTATATATTCTGG - Intronic
986816439 5:11417434-11417456 TTGGAGTTCATTGTATATTCTGG - Intronic
986931058 5:12822062-12822084 TTTGAGTTGCTTGTAGATTCTGG + Intergenic
986932519 5:12843825-12843847 TTTATGTTCCTTGTAGATTCTGG + Intergenic
987003203 5:13682011-13682033 TTGTGGTGGCTTGTATCATCTGG - Intergenic
987161318 5:15146494-15146516 TTTGAGTTCCTTGTATATTCTGG - Intergenic
987822850 5:22988292-22988314 TTTGAGTTTCTTGTATATTCTGG - Intergenic
987852873 5:23379849-23379871 TTGTTGTTATTGGTCTATTCAGG - Intergenic
988126846 5:27051223-27051245 TTGTTGTTTCTAGCATATTAAGG - Intronic
988332224 5:29856794-29856816 TTTAAGTTTCTTGTATATTCTGG + Intergenic
988368447 5:30334049-30334071 TTTTAGTTCCTTGCATATTCTGG - Intergenic
988384782 5:30547899-30547921 TTTTTGTTGCTTGTCTTTTGTGG - Intergenic
988462205 5:31449928-31449950 TTTTAGTTCCTTGTAGATTCTGG - Intronic
988788715 5:34587672-34587694 TTGTTTTTGCTTTTGTTTTCTGG - Intergenic
989032090 5:37129519-37129541 TTTGAGTTCCTTGTATATTCTGG - Intronic
989081398 5:37625864-37625886 TTTCTGTTCTTTGTATATTCTGG + Intronic
989297338 5:39845119-39845141 TTTGAGTTCCTTGTATATTCTGG + Intergenic
989311168 5:40019881-40019903 TTGTTGTTGTTTGTTTGTTTGGG - Intergenic
989491741 5:42063472-42063494 TTTTTGTTGCTTTTACATTTTGG - Intergenic
989757277 5:44970665-44970687 TTGGAGTTCCTTGTATATTCTGG - Intergenic
989998262 5:50861341-50861363 ATTTTTTTTCTTGTATATTCTGG - Intergenic
990110082 5:52312378-52312400 TTGTTGTTGTTTGTTTACTTGGG - Intergenic
990233003 5:53735390-53735412 TTTATGTTCCTTGTAGATTCTGG + Intergenic
990585352 5:57206354-57206376 TAGTTTTTGCTTTTATATTTAGG + Intronic
990689257 5:58344888-58344910 TTTTAGTTCCTTGTAGATTCTGG - Intergenic
990745126 5:58951237-58951259 TTTGAGTTCCTTGTATATTCTGG - Intergenic
990843521 5:60110291-60110313 TTTGAGTTCCTTGTATATTCTGG - Intronic
991019513 5:61965272-61965294 TTATTGTTGCTTTTATCTTCAGG - Intergenic
991106311 5:62846527-62846549 TTTCAGTTCCTTGTATATTCTGG + Intergenic
991532186 5:67627827-67627849 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
991543575 5:67756923-67756945 TTGGAGTTCCTTGTAGATTCTGG - Intergenic
991906624 5:71520177-71520199 TTTTTGTTCCTTATATATTCTGG + Intronic
992514073 5:77473564-77473586 TTGGTGTTCATTGTAGATTCTGG - Intronic
992994655 5:82320770-82320792 TTGTTGTTGTTTGTAGAGACAGG - Intronic
993237192 5:85327033-85327055 TAGTTGTAGCTTTTATATTTAGG + Intergenic
993631736 5:90294038-90294060 TCCCTGTTGCTTGTCTATTCTGG - Intergenic
993821137 5:92618338-92618360 TTTGAGTTCCTTGTATATTCTGG + Intergenic
994133595 5:96260154-96260176 TTGTTGTTGTTTTTTTAATCTGG - Intergenic
994225061 5:97242199-97242221 TAGTTGTGGTTAGTATATTCGGG + Intergenic
994641518 5:102415826-102415848 TTTGAGTTCCTTGTATATTCTGG - Intronic
994717778 5:103343990-103344012 TTCTCTTTGCTTGTATTTTCTGG + Intergenic
994866307 5:105276268-105276290 TTTGAGTTTCTTGTATATTCTGG - Intergenic
994872200 5:105366429-105366451 TTTGAGTTCCTTGTATATTCTGG - Intergenic
994919306 5:106022211-106022233 TTTTTGATGCTTTTATTTTCAGG - Intergenic
994950861 5:106460416-106460438 TTGTTTTTGATTTTCTATTCAGG + Intergenic
995034501 5:107517977-107517999 TTGTTGTTGCATATATAGTTTGG - Intronic
995262787 5:110124780-110124802 TTGAAGTTCCTTGTAAATTCTGG + Intergenic
995292480 5:110473209-110473231 TTTCAGTTTCTTGTATATTCTGG - Intronic
995632187 5:114145985-114146007 TCGTTGTTGCATGCATCTTCAGG + Intergenic
995809947 5:116094290-116094312 TTTGAGTTCCTTGTATATTCTGG - Intronic
995956680 5:117784960-117784982 TTGTTGTTCATGGAATATTCTGG + Intergenic
996254340 5:121379705-121379727 TTTGAGTTTCTTGTATATTCTGG - Intergenic
996448354 5:123585590-123585612 TAATAGTTCCTTGTATATTCTGG - Intronic
996489377 5:124074942-124074964 CTTTAGTTCCTTGTATATTCTGG + Intergenic
996495533 5:124150707-124150729 TTTGTGTTCCTTGTAGATTCTGG - Intergenic
996605634 5:125318214-125318236 TTGTTTTTGCTTTTTTATTGTGG + Intergenic
996969538 5:129347124-129347146 TGTATGTTCCTTGTATATTCTGG + Intergenic
997593394 5:135089898-135089920 TTTGAGTTCCTTGTATATTCTGG - Intronic
997774415 5:136587727-136587749 TTTTAGTTTCTTGTATATTCTGG - Intergenic
997959839 5:138311823-138311845 TTGTAGTTCTTTATATATTCTGG - Intronic
998190680 5:140021668-140021690 TCCTTGTTGCCTGTGTATTCAGG - Intronic
998722638 5:144972216-144972238 TTTATGTTGCTTGTATTTTCTGG - Intergenic
999025435 5:148225648-148225670 TTTGAGTTGCTTGTAGATTCTGG + Intergenic
999350667 5:150867855-150867877 TTTTAGTTCCTTGTAGATTCTGG + Intronic
1000035410 5:157443956-157443978 TTTTTGTTGTTTGTATTTTAGGG - Intronic
1000406945 5:160898270-160898292 TGTTTGTTTCTTGTAGATTCTGG - Intergenic
1000417385 5:160997267-160997289 TTGAAGTTTCTTGTAGATTCTGG + Intergenic
1000548544 5:162631041-162631063 TTAAAGTTCCTTGTATATTCTGG - Intergenic
1000571400 5:162918518-162918540 TTGTTTTTCCTTATATATTTTGG + Intergenic
1000928567 5:167224062-167224084 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1001706541 5:173745015-173745037 TTGTTGTTGCTGTTTTAATCTGG - Intergenic
1002003453 5:176212978-176213000 TGGTTGTTGCTTTTCTTTTCTGG - Intergenic
1002871880 6:1173777-1173799 TTTTAGTTCCTTGTAGATTCTGG + Intergenic
1004449832 6:15735160-15735182 TTGTTGTTGTTTGTTTTTTTTGG + Intergenic
1004873849 6:19935531-19935553 TTGTTGTTGTTTGCATATATGGG - Intergenic
1005901926 6:30223958-30223980 TATTTGTTTTTTGTATATTCTGG + Intergenic
1006864467 6:37197972-37197994 TTGGAGTTCCTTGTAGATTCTGG - Intergenic
1006999275 6:38293940-38293962 TTGAAGTTCCTTGTAGATTCTGG - Intronic
1007010244 6:38409900-38409922 TTGTTTTTGGTTTTATACTCAGG - Intronic
1008195491 6:48514669-48514691 TTGTGGTTGTTTGTATTTTTTGG + Intergenic
1008289898 6:49702671-49702693 TTTTAGTTCCTTGTAGATTCTGG + Intronic
1008672434 6:53785061-53785083 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1008776360 6:55043590-55043612 CTTGTGTTTCTTGTATATTCTGG + Intergenic
1008784751 6:55154091-55154113 TGGTTGTTACTGGTATGTTCAGG - Intronic
1008819473 6:55613070-55613092 TTTATGTTTCTTGTAAATTCTGG - Intergenic
1008868364 6:56242670-56242692 TTGTTGTTTCTTGGACATTTTGG - Intronic
1008973393 6:57396694-57396716 TATTTGTTGCTTGTATATCTTGG + Intronic
1009162297 6:60298238-60298260 TATTTGTTGCTTGTATATCTTGG + Intergenic
1009264588 6:61537028-61537050 TTTAAGTTCCTTGTATATTCTGG - Intergenic
1009486634 6:64232387-64232409 TTGTTGTTGTTTGTTTGTTTGGG + Intronic
1009547774 6:65044259-65044281 TTTTTGTTCCTTATATATTTTGG + Intronic
1010950232 6:82027949-82027971 TTGTTGTTGTTTGTTTGTTTTGG + Intergenic
1011019331 6:82793997-82794019 TTTGAGTTTCTTGTATATTCTGG - Intergenic
1011128516 6:84032035-84032057 TTTAAGTTGCTTGTACATTCTGG + Intergenic
1011432966 6:87307495-87307517 TTGGAGTTCCTTGTAGATTCTGG - Intronic
1011806352 6:91077106-91077128 TGGTTGTTTCTTATATAATCTGG - Intergenic
1011916768 6:92515570-92515592 TTTATGTTCCTTGTAGATTCTGG - Intergenic
1012070806 6:94613222-94613244 TTGAAGTTCCTTGTAAATTCTGG - Intergenic
1012284346 6:97370288-97370310 TTGTTTTTCTTTGTATTTTCAGG + Intergenic
1012302587 6:97607690-97607712 TGTTTGTTTCTTGTAGATTCTGG + Intergenic
1012303014 6:97613125-97613147 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1012364686 6:98424211-98424233 TTTAAGTTGCTTGTAGATTCTGG + Intergenic
1012782698 6:103582859-103582881 TTTTTTTTCCTTGTAGATTCAGG - Intergenic
1012902434 6:105021689-105021711 TTTGAGTTCCTTGTATATTCTGG + Intronic
1012966015 6:105674216-105674238 TTGTTTTTCCTTGTAGATTCTGG - Intergenic
1013453866 6:110311919-110311941 TTTGAGTTCCTTGTATATTCTGG + Intronic
1013670376 6:112395842-112395864 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1013875036 6:114815039-114815061 TAGTTGTTCCTTTTGTATTCTGG + Intergenic
1013983597 6:116163241-116163263 TTGTTGTTGTTTGTTTGTTTTGG + Intronic
1014059889 6:117059406-117059428 TTTATGTTCCTTGTAGATTCTGG + Intergenic
1014386699 6:120812167-120812189 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1014402078 6:121002492-121002514 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1014450518 6:121576469-121576491 TTATTGTTGTTTGTTTATTTGGG - Intergenic
1014616990 6:123614918-123614940 TTTGAGTTTCTTGTATATTCTGG - Intronic
1014724484 6:124958506-124958528 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1014859154 6:126442324-126442346 TTTTAGTTCCTTGTAGATTCTGG + Intergenic
1015063420 6:128996400-128996422 TTTATGTTCCTTGTAGATTCTGG - Intronic
1015607374 6:134972463-134972485 TTGTTTTTGCTTTTATATTTAGG - Intronic
1015618285 6:135102518-135102540 TTGTAGTTCTTTATATATTCTGG + Intronic
1016247453 6:142000305-142000327 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1016828061 6:148406215-148406237 TTGTTTGTGCTTGTTTGTTCTGG + Intronic
1016934316 6:149437621-149437643 TTTTAGTTCCTTGTAGATTCTGG + Intergenic
1017251660 6:152286670-152286692 ATGGAGTTGTTTGTATATTCTGG + Intronic
1017301242 6:152861120-152861142 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1017413281 6:154192631-154192653 TTTGTGTTCCTTGTAGATTCTGG - Intronic
1017437667 6:154432389-154432411 TTCTTGTTCTTTGTATATTTTGG + Intronic
1017734048 6:157344608-157344630 TTATTGTTGCTTGTGTTTTTGGG + Intergenic
1017932071 6:158964686-158964708 TTGTAATTCTTTGTATATTCTGG + Intergenic
1018034498 6:159870365-159870387 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1018134785 6:160768532-160768554 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1018150079 6:160929861-160929883 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1018250065 6:161860615-161860637 TTGAAGTTCCTTGTAGATTCTGG + Intronic
1018494319 6:164333356-164333378 TTGTTATTCCTTATATATTTAGG - Intergenic
1019009943 6:168836503-168836525 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1020064843 7:5179910-5179932 TTGTTGTTGCTTGTTGCTGCTGG + Intergenic
1020523070 7:9219578-9219600 TAGTTGTTGTTGGTATATCCAGG - Intergenic
1020716518 7:11680471-11680493 TTTAAGTTGCTTGTAGATTCTGG - Intronic
1020873799 7:13668944-13668966 TTTAAGTTGCTTGTAGATTCTGG + Intergenic
1021173850 7:17427235-17427257 GTGTGTTTGTTTGTATATTCTGG + Intergenic
1021187534 7:17582656-17582678 TTTTTTTTTCTTGTAAATTCTGG - Intergenic
1021489639 7:21204964-21204986 TTTTTTTTTCTTGGATATTCAGG - Intergenic
1021501830 7:21340219-21340241 TTTATGTTCCTTGTAGATTCTGG + Intergenic
1021858601 7:24882947-24882969 TTTGAGTTCCTTGTATATTCTGG + Intronic
1022293633 7:29028611-29028633 CTTGAGTTGCTTGTATATTCTGG - Intronic
1022425378 7:30263818-30263840 TTGTTGTTGCTATTATTTTGGGG - Intergenic
1022661263 7:32369265-32369287 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1023128411 7:36977925-36977947 TTATTGTAGCTTCCATATTCTGG + Intronic
1023197003 7:37651983-37652005 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1023315944 7:38936598-38936620 TTGTAGTTCTTTGTATATTCTGG + Intergenic
1023751949 7:43381213-43381235 TTGTAGTTCTTTATATATTCTGG + Intronic
1023971631 7:44995740-44995762 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1024213145 7:47224208-47224230 TTATTGTTGCTTGTACCTTTGGG + Intergenic
1024351098 7:48365287-48365309 TTTGAGTTTCTTGTATATTCAGG + Intronic
1024894030 7:54236290-54236312 TTTGTGTTTCTTGTAGATTCTGG - Intergenic
1024991283 7:55236188-55236210 TTGGTGTTGTTTGTAAATTCGGG - Intronic
1024994871 7:55266097-55266119 TTTGTGTTCCTTGTATATTTTGG - Intergenic
1024999689 7:55305123-55305145 TTTTAGTTCCTTGTAGATTCTGG - Intergenic
1025799930 7:64776370-64776392 TTGGAGTTGTTTATATATTCTGG + Intergenic
1026395206 7:69945606-69945628 TTGTTGTTGTTTGTTTTTTTGGG + Intronic
1027401948 7:77818132-77818154 TTTGAGTTCCTTGTATATTCTGG + Intronic
1028002696 7:85520151-85520173 TTTTTCTTGCTTATAAATTCTGG - Intergenic
1028027936 7:85869881-85869903 TACTTGTTACTTGTCTATTCAGG - Intergenic
1028068800 7:86423142-86423164 GTGTTTTTGCTTGTATTTTAGGG - Intergenic
1028224046 7:88229076-88229098 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1028442992 7:90885206-90885228 TTTATGTTCCTTGTAAATTCTGG - Intronic
1028445718 7:90921197-90921219 TTGTTGCTCCTTGTATACTGTGG + Intronic
1028803113 7:94991398-94991420 TTTGAGTTTCTTGTATATTCTGG + Intronic
1028816258 7:95148812-95148834 TTATCTTTGCTTTTATATTCTGG - Intronic
1029003243 7:97178719-97178741 TTGTGGTTCTTTATATATTCTGG + Intronic
1029060308 7:97790841-97790863 TTTGTGTTCTTTGTATATTCTGG - Intergenic
1029792279 7:102857349-102857371 TTTGAGTTCCTTGTATATTCTGG - Intronic
1029879233 7:103789460-103789482 TTTAAGTTCCTTGTATATTCTGG - Intronic
1030178980 7:106685253-106685275 TTGTAGTTCTTTGTAGATTCTGG + Intergenic
1030604676 7:111627078-111627100 TTTCAGTTCCTTGTATATTCTGG + Intergenic
1030604684 7:111627234-111627256 GTTTTGTTGCTTGTATTTTTGGG + Intergenic
1030650076 7:112107979-112108001 TTGTTGTTGCATGTGAAGTCTGG - Intronic
1030802608 7:113870871-113870893 TTTCAGTTTCTTGTATATTCTGG - Intergenic
1031071164 7:117163665-117163687 TTTGAGTTCCTTGTATATTCTGG + Intronic
1031111631 7:117617687-117617709 GTGTTCTTGCTCCTATATTCAGG + Intronic
1031189267 7:118525965-118525987 TTTATGTTTCTTGTAGATTCTGG + Intergenic
1031472266 7:122181216-122181238 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1031507082 7:122598429-122598451 TTGTTGCTGCTAAAATATTCTGG + Intronic
1031529708 7:122861471-122861493 TTGGAGTTCCTTGCATATTCTGG + Intronic
1031565178 7:123287532-123287554 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1031894569 7:127334331-127334353 TTATTGTTTGTTATATATTCTGG - Intergenic
1032311090 7:130787859-130787881 ATGTTGCCTCTTGTATATTCTGG + Intergenic
1032816528 7:135481209-135481231 TTTGAGTTTCTTGTATATTCTGG - Intronic
1033183542 7:139203992-139204014 ATGTAGTTGCATGTATTTTCAGG - Intergenic
1033717255 7:144015479-144015501 TTTATGTTCCTTGTAGATTCTGG - Intergenic
1033768311 7:144519817-144519839 TTGTTGTTGTTTGTTAAGTCTGG - Intronic
1033995979 7:147348274-147348296 CTTTAGTTCCTTGTATATTCTGG - Intronic
1034208060 7:149335683-149335705 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1034614385 7:152402712-152402734 TTTGTGTTCCTTGTAAATTCTGG - Intronic
1035086462 7:156263456-156263478 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
1035145686 7:156813101-156813123 TTTTTGTTGTTTGTAGATACAGG + Intronic
1035494169 7:159307417-159307439 TTCTTGTTGACTGTATTTTCAGG + Intergenic
1036819186 8:11926050-11926072 CTGTTGTTGTTTGTTTGTTCTGG - Intergenic
1037279817 8:17226774-17226796 TTGTTGTACCTTGTAATTTCAGG + Intergenic
1037798997 8:22021507-22021529 TTTGTATTCCTTGTATATTCTGG - Intergenic
1038001013 8:23391233-23391255 TTGTTGTTGTTTGTTTGTTAAGG - Intronic
1038182971 8:25246271-25246293 TTGTTGTTTTTTGTATTTTTTGG + Intronic
1038236381 8:25761356-25761378 TTTAAGTTCCTTGTATATTCTGG - Intergenic
1038997500 8:32941015-32941037 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1040027310 8:42793702-42793724 TTTGAGTTTCTTGTATATTCTGG + Intronic
1040457068 8:47609271-47609293 TTATTATTGCTTGTGTTTTCAGG + Intronic
1040933350 8:52758039-52758061 TTTGGGTTCCTTGTATATTCTGG - Intergenic
1040984029 8:53273637-53273659 TAATTGTTCTTTGTATATTCTGG - Intergenic
1041269446 8:56096946-56096968 TTGTTTTTGCTTTTAAATTCTGG + Intergenic
1041620341 8:59960279-59960301 TTGGTGTATCTTGGATATTCAGG + Intergenic
1041746942 8:61217777-61217799 TTTGAGTTCCTTGTATATTCTGG - Intronic
1041761469 8:61371363-61371385 TTGGAGTTCCTTGTAGATTCTGG + Intronic
1041817699 8:61993747-61993769 TTTATGTTCCTTGTAGATTCTGG - Intergenic
1042181597 8:66093200-66093222 ATGTTCTTGCATGTATTTTCTGG + Intronic
1042387546 8:68194905-68194927 TTGTTGTTGCTTGAACACACTGG - Intronic
1042805686 8:72768581-72768603 TTGTTGTTGCTTGTACTTTTTGG + Intronic
1043040427 8:75255465-75255487 TTTGTGTTTCTTGTGTATTCTGG - Intergenic
1043251834 8:78084494-78084516 TTGTTGTTGTTTATTTATTTAGG - Intergenic
1043277806 8:78422039-78422061 TTGTTTTTGCTTGTGCATTTGGG + Intergenic
1043597773 8:81904130-81904152 TTGTTGTAGCTTGGATACCCTGG + Intergenic
1043830026 8:84977165-84977187 TTATGGTTGCTTTTATGTTCTGG + Intergenic
1044025713 8:87169294-87169316 TTGTTTGAGCTTATATATTCTGG + Intronic
1044046493 8:87441200-87441222 TTTGAGTTCCTTGTATATTCTGG + Intronic
1044292886 8:90493355-90493377 TTTGTGTTCCTTGTAGATTCTGG - Intergenic
1044508814 8:93051455-93051477 TTGTTGATGCTCGTGTATTCAGG - Intergenic
1044872690 8:96635249-96635271 TTGTAGTTCTTTATATATTCTGG + Intergenic
1045554679 8:103204447-103204469 TTGTTGTTGCTTGTGCTTTTGGG + Intronic
1045877998 8:107004993-107005015 TTTAAGTTGCTTGTAGATTCTGG - Intergenic
1046011412 8:108552882-108552904 TTCTTTTTGCTTGGCTATTCGGG - Intergenic
1046241549 8:111502118-111502140 TTGTTGTTGTTTGTTTATATGGG + Intergenic
1046318587 8:112540019-112540041 TTTTAGTTCCTTATATATTCTGG - Intronic
1046556149 8:115775802-115775824 TAGTTATTGCTTGAATATCCTGG + Intronic
1047130335 8:122012668-122012690 TTTTTGTTCCTTATAGATTCTGG + Intergenic
1048100049 8:131341490-131341512 TTGTTGATGGTTGTATCTGCAGG - Intergenic
1048428869 8:134349117-134349139 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
1049722097 8:144122687-144122709 TTCGAGTTTCTTGTATATTCTGG - Intergenic
1050152525 9:2630945-2630967 TTGTTTGAGTTTGTATATTCTGG - Intronic
1050439699 9:5648875-5648897 TTTGAGTTCCTTGTATATTCTGG + Intronic
1050505685 9:6346314-6346336 TTTTAGTTCCTTGTATTTTCTGG - Intergenic
1050716140 9:8528617-8528639 TTGTTGTTGCTTGTGTCCACAGG + Exonic
1051211114 9:14745489-14745511 TTGAAGTTGTTTGTATTTTCTGG + Intronic
1051232980 9:14972258-14972280 TTTATGTTCTTTGTATATTCTGG - Intergenic
1051301966 9:15661677-15661699 TTGTTATTGTTTGTATATTTTGG + Intronic
1051321122 9:15906392-15906414 TTGTTGGTTCTTTTATATGCTGG - Intronic
1051465618 9:17374234-17374256 TTTTAGCTGCTTATATATTCTGG - Intronic
1051610931 9:18960604-18960626 ATGTTGTTTTTTGTAGATTCGGG - Intronic
1051695337 9:19762179-19762201 TTGAAGTTCCTTGTAGATTCTGG + Intronic
1051936053 9:22444139-22444161 TTTTTGTTTCTTGTATTTTGAGG + Intergenic
1051962776 9:22788628-22788650 TTGAAGTTCCTTGTAGATTCTGG - Intergenic
1052386817 9:27832420-27832442 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
1052450420 9:28623062-28623084 TTTTTGCTCCTTGTATATTCTGG + Intronic
1052672206 9:31572416-31572438 TTGCAGTTTCTTGTATATTCTGG + Intergenic
1053485105 9:38446958-38446980 TTTAAGTTGCTTATATATTCTGG + Intergenic
1054777432 9:69135440-69135462 TTGTTGTTGTTTGTTTTTTGAGG + Intronic
1054802675 9:69366413-69366435 TTTGAGTTTCTTGTATATTCCGG + Intronic
1055484233 9:76741519-76741541 TTCTTTTTGTTTGTATGTTCTGG - Intronic
1055562821 9:77537942-77537964 TTTGAGTTCCTTGTATATTCTGG + Intronic
1056001435 9:82221194-82221216 TTTTAGTTCCTTGTAGATTCTGG - Intergenic
1056033538 9:82579870-82579892 TTGTAGTTCTTTATATATTCTGG - Intergenic
1056159808 9:83877528-83877550 TGGTTTTTGCTTTTATATTTAGG - Intronic
1056293204 9:85165164-85165186 TTGGTGTTCATTGTAGATTCTGG - Intergenic
1056360418 9:85852277-85852299 TGGTTTTTGCTTTTATATTTAGG + Intergenic
1056556118 9:87689388-87689410 TTTGAGTTCCTTGTATATTCTGG + Intronic
1057932343 9:99205521-99205543 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1058015608 9:100029304-100029326 TTGTTGTTGCTTGTATATTCTGG - Intronic
1058144349 9:101395046-101395068 TTTGGGTTCCTTGTATATTCTGG - Intronic
1058305344 9:103434460-103434482 TTGGAGTTGTTTGTAGATTCTGG + Intergenic
1058331913 9:103772511-103772533 TTGGAGTTCCTTGTAAATTCTGG + Intergenic
1058369789 9:104252734-104252756 TTTTAGTTCCTTGTAGATTCTGG + Intergenic
1058413536 9:104761986-104762008 TTTGAGTTTCTTGTATATTCTGG - Intergenic
1058728819 9:107829641-107829663 TTTTAGTTTCTTATATATTCTGG + Intergenic
1058764886 9:108172499-108172521 TTAGTGTTCCTTGTAGATTCTGG + Intergenic
1059758059 9:117312171-117312193 CTCTTGTTGCTAATATATTCAGG + Intronic
1059920505 9:119155154-119155176 TTGTTGTTGCTGTTGTTTTCAGG + Intronic
1060433622 9:123572917-123572939 TTGTTTTTGCTTCTATTTTTAGG + Intronic
1060520422 9:124291033-124291055 TTGTTATTGCATCTTTATTCGGG - Intronic
1185875737 X:3700762-3700784 TTGTTGTTGTTTGTAGAGACAGG + Intronic
1186197464 X:7123881-7123903 TTTTTGCTGCTTGTATTTTGGGG - Intronic
1186838800 X:13464684-13464706 TTGCTGTTGTTTGTATTTTGTGG + Intergenic
1186919265 X:14260125-14260147 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
1187634898 X:21216672-21216694 TTGAAGTTCCTTGTAGATTCTGG - Intergenic
1187713924 X:22082579-22082601 TTTATGTTCCTTGTAAATTCTGG + Intronic
1188102310 X:26104483-26104505 TTGTAGTTATTTCTATATTCTGG - Intergenic
1188144562 X:26594930-26594952 TTTTAGTTCCTTATATATTCTGG - Intergenic
1188350485 X:29124531-29124553 TTCTTGTTGGATGTAGATTCTGG - Intronic
1188653334 X:32659083-32659105 TTGTTGTTAGTTCTCTATTCTGG - Intronic
1188717970 X:33484381-33484403 TTTGAGTTACTTGTATATTCTGG - Intergenic
1188739441 X:33760210-33760232 TTCATGCTCCTTGTATATTCTGG + Intergenic
1188977828 X:36696759-36696781 TTTAAGTTGCTTGTAAATTCCGG + Intergenic
1189001788 X:36955871-36955893 TTTTAGTTGCTTATATATTTGGG - Intergenic
1189535615 X:41932418-41932440 TTGTAGTTCCTTGTATATTCTGG - Intergenic
1189721389 X:43922770-43922792 TTTAAGTTGCTTGTAGATTCTGG + Intergenic
1189870995 X:45382319-45382341 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1189935264 X:46061081-46061103 TTTATGTTCCTTGTAGATTCTGG - Intergenic
1190047331 X:47123161-47123183 TTGTTGTTGTTTGTTTTTTGAGG - Intergenic
1190141507 X:47849752-47849774 TTGTTGTTCTTGATATATTCTGG - Intronic
1190371451 X:49746181-49746203 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1190580177 X:51885460-51885482 TTGGAGTTCCTTATATATTCTGG + Intronic
1190721138 X:53149356-53149378 TTGGAGTTCCTTGTAGATTCTGG - Intergenic
1190724916 X:53182717-53182739 TAGGAGTTGTTTGTATATTCTGG + Intergenic
1190901506 X:54678576-54678598 TTTTAGTTCCTTGTAAATTCCGG + Intergenic
1190933779 X:54974723-54974745 TTTGAGTTTCTTGTATATTCTGG - Intronic
1190975094 X:55391336-55391358 TTGGTGTTCTTTGTAGATTCTGG - Intergenic
1191005328 X:55704886-55704908 TTTTTGGTGCATGTATATTTGGG - Intergenic
1191140437 X:57110950-57110972 TTTGAGTTGCTTGTAGATTCTGG - Intergenic
1191629653 X:63309051-63309073 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1191635060 X:63367304-63367326 TTTTAGTTTCTTATATATTCTGG - Intergenic
1191702232 X:64055063-64055085 TTGTTAGTGCTTGACTATTCTGG - Intergenic
1191950485 X:66586156-66586178 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
1192096396 X:68216757-68216779 TTGGAGTTCCTTGTAGATTCTGG - Intronic
1192137281 X:68615279-68615301 TTGAAGTTCCTTGTAGATTCTGG - Intergenic
1192379831 X:70603822-70603844 TTGGAGTTCCTTGTAGATTCTGG - Intronic
1193035133 X:76941756-76941778 TTGAAGTTCCTTGTAGATTCTGG - Intergenic
1193039833 X:76993137-76993159 TTGAAGTTCCTTGTAGATTCTGG + Intergenic
1193059467 X:77189720-77189742 TTGGTGTTCATTGTAGATTCTGG - Intergenic
1193069034 X:77288076-77288098 TTTATGTTCCTTGTAAATTCTGG - Intergenic
1193220751 X:78923446-78923468 TTGTTGTTGTTTGTTTTTTTAGG - Intergenic
1193493379 X:82179032-82179054 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1193494563 X:82195281-82195303 TTTTGGTTGCATGTATATTTAGG + Intergenic
1193549045 X:82866972-82866994 TTGTGGTTGCTTATAGATTTTGG + Intergenic
1193643276 X:84037928-84037950 TTTTTGTTCCTTGTTGATTCTGG + Intergenic
1193726809 X:85050592-85050614 TTTTTTTTGCTTTTATATTTAGG - Intronic
1193775576 X:85637051-85637073 TTTTAGTTCCTTGTAGATTCTGG + Intergenic
1193867593 X:86755290-86755312 TTTGAGTTCCTTGTATATTCTGG + Intronic
1193897709 X:87133655-87133677 TTTAAGTTGCTTGTAGATTCTGG - Intergenic
1194189479 X:90816962-90816984 TTGTAGTTCTTTGTATATTCTGG + Intergenic
1194212790 X:91089086-91089108 TTTATGTTCCTTGTAGATTCTGG + Intergenic
1194251623 X:91582806-91582828 TTTGGGTTCCTTGTATATTCTGG + Intergenic
1194300983 X:92185628-92185650 TTTGAGTTCCTTGTATATTCTGG - Intronic
1194514863 X:94840071-94840093 TTTATGTTCCTTGTAGATTCTGG + Intergenic
1194557299 X:95376206-95376228 TTTGTGTTCCTTGTAGATTCTGG - Intergenic
1194573248 X:95578704-95578726 TAAGTGTTCCTTGTATATTCTGG + Intergenic
1194658597 X:96602891-96602913 TTGGAGTTCCTTGTAGATTCTGG - Intergenic
1194661500 X:96633112-96633134 TTGAAGTTTCTTGTAGATTCTGG - Intergenic
1194706388 X:97180375-97180397 TTGAAGTTTCTTGTAGATTCTGG + Intronic
1194806868 X:98340069-98340091 TTTTAGTTCCCTGTATATTCTGG + Intergenic
1194974655 X:100381649-100381671 TTGTTCTTGCTTTTTTGTTCAGG - Intronic
1195293084 X:103448071-103448093 TTTGAGTTTCTTGTATATTCTGG + Intergenic
1195368914 X:104153814-104153836 TTTTTGTTGTTTGTATGTTTTGG - Intronic
1195745103 X:108109346-108109368 TTGTTGTTCTTTATATATTCTGG + Intronic
1195912974 X:109907311-109907333 TTTGTGTTCCTTGTAGATTCTGG + Intergenic
1195976122 X:110529102-110529124 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1195987865 X:110650548-110650570 TTTGAGTTCCTTGTATATTCTGG + Intergenic
1196318705 X:114263033-114263055 TTTTTGTTCCTTATATATTTTGG - Intergenic
1196333090 X:114495057-114495079 TTATTGGTCCTTGTATTTTCTGG - Intergenic
1196383124 X:115115822-115115844 TTGTAGTTCCTTATGTATTCTGG - Intronic
1196460635 X:115925828-115925850 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1196543437 X:116935848-116935870 TTGGTGTTCCTTTTATATCCAGG + Intergenic
1196586304 X:117432993-117433015 TTTGTGTTTCTTGTAGATTCTGG + Intergenic
1196998445 X:121410295-121410317 GTATTGTTCCTTATATATTCTGG + Intergenic
1197005136 X:121487312-121487334 TTGTTGTTGATGGGCTATTCAGG + Intergenic
1197010491 X:121556200-121556222 TTTGAGTTTCTTGTATATTCTGG - Intergenic
1197020300 X:121679275-121679297 TTTGAGTTTCTTGTATATTCTGG - Intergenic
1197166786 X:123386328-123386350 TTTGAGTTCCTTGTATATTCTGG + Intronic
1197302506 X:124798559-124798581 TTTATGTTCCTTGTAGATTCTGG + Intronic
1197339346 X:125246600-125246622 TTTGAGTTGCTTGTAAATTCTGG - Intergenic
1197364533 X:125547408-125547430 TTTGTGTTCCTTATATATTCTGG + Intergenic
1197367084 X:125577179-125577201 TTTGTGCTGCTTGTACATTCTGG - Intergenic
1197369282 X:125606310-125606332 TTTGTGCTCCTTGTATATTCTGG + Intergenic
1197494643 X:127162622-127162644 TTTGAGTTGCTTATATATTCTGG + Intergenic
1197618368 X:128719504-128719526 TCATTGTTCCTTGTAAATTCTGG - Intergenic
1197804755 X:130388008-130388030 TTGAAGTTCCTTGTAGATTCTGG - Intergenic
1197904605 X:131411705-131411727 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1197908136 X:131449035-131449057 TTGTTGTTGCTAGTGTTTTCAGG + Intergenic
1198277480 X:135110030-135110052 ATGTTGGTGCATGTATATTTAGG + Intergenic
1198544699 X:137678753-137678775 TTTAAGTTGCTTGTAGATTCTGG - Intergenic
1198550427 X:137739571-137739593 TTTGGGTTCCTTGTATATTCTGG + Intergenic
1198748307 X:139913247-139913269 TTGTTGATGCTGGAATATTACGG - Intronic
1199003806 X:142672726-142672748 TTGGTGTTCCTTGTAGATTCTGG + Intergenic
1199155697 X:144546543-144546565 TTGTTGTTGTTTGTTTGTTGTGG + Intergenic
1199156792 X:144558921-144558943 TTTTAGTTTCTTGTTTATTCTGG + Intergenic
1199212832 X:145233913-145233935 TTCTTGATGTTTGTTTATTCCGG + Intergenic
1199340502 X:146671615-146671637 TTGTTGTTACTTGTTTCTCCTGG - Intergenic
1199490450 X:148393053-148393075 TTTGAGTTCCTTGTATATTCTGG - Intergenic
1199514533 X:148661281-148661303 TAGTGTTTGCCTGTATATTCTGG - Intronic
1199586673 X:149422296-149422318 TTTTTGTTAGTTGTCTATTCAGG - Intergenic
1199597713 X:149520973-149520995 TTTTAGTTCCTTGTAGATTCTGG - Intronic
1199885076 X:152012187-152012209 TTTGAGTTCCTTGTATATTCAGG - Intergenic
1200334726 X:155337701-155337723 TTGGAGTTTCTTGTAGATTCTGG + Intergenic
1200351740 X:155503520-155503542 TTGGAGTTTCTTGTAGATTCTGG - Intronic
1200435831 Y:3149168-3149190 TTTGTGTTCCTTATATATTCTGG + Intergenic
1200536059 Y:4398852-4398874 TTATAGTTCTTTGTATATTCTGG + Intergenic
1200570560 Y:4824038-4824060 TTTGGGTTCCTTGTATATTCTGG + Intergenic
1200876990 Y:8167162-8167184 TTGTTGTTGTTTGTTTCTTAAGG + Intergenic
1201056682 Y:10000512-10000534 TTGTTGTTGTTTGTTTCTTAAGG - Intergenic
1201188403 Y:11426103-11426125 TTGGTGTTCATTGTAGATTCTGG - Intergenic
1201622541 Y:15976218-15976240 TCGTTGTTGCATGCATTTTCAGG + Intergenic
1201732336 Y:17218001-17218023 TTGGTGTTCATTGTAGATTCTGG - Intergenic
1201796274 Y:17899896-17899918 TTGGTGTTCATTGTAGATTCTGG - Intergenic
1201805281 Y:18006089-18006111 TTGGTGTTCATTGTAGATTCTGG + Intergenic
1201929516 Y:19327272-19327294 TTTATGTTTCTTGTAGATTCTGG - Intergenic
1201960522 Y:19676139-19676161 GTGTTATTGCTTAGATATTCAGG + Intergenic
1202357671 Y:24068959-24068981 TTGGTGTTCATTGTAGATTCTGG - Intergenic
1202513107 Y:25601154-25601176 TTGGTGTTCATTGTAGATTCTGG + Intergenic