ID: 1058017016

View in Genome Browser
Species Human (GRCh38)
Location 9:100044940-100044962
Sequence GCGAATTCTCCATTTCTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058017011_1058017016 18 Left 1058017011 9:100044899-100044921 CCTGTAATAGGACATTTTAAGTT 0: 1
1: 0
2: 0
3: 7
4: 191
Right 1058017016 9:100044940-100044962 GCGAATTCTCCATTTCTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058017016 Original CRISPR GCGAATTCTCCATTTCTATG GGG Intronic
No off target data available for this crispr