ID: 1058022293

View in Genome Browser
Species Human (GRCh38)
Location 9:100102251-100102273
Sequence CACAAAAATTAGCTGGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3327
Summary {0: 1, 1: 23, 2: 172, 3: 1064, 4: 2067}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058022293_1058022298 -7 Left 1058022293 9:100102251-100102273 CCACAGCCCAGCTAATTTTTGTG 0: 1
1: 23
2: 172
3: 1064
4: 2067
Right 1058022298 9:100102267-100102289 TTTTGTGTTTTTAGTAGGGACGG 0: 93
1: 9772
2: 205416
3: 141244
4: 69223
1058022293_1058022299 -6 Left 1058022293 9:100102251-100102273 CCACAGCCCAGCTAATTTTTGTG 0: 1
1: 23
2: 172
3: 1064
4: 2067
Right 1058022299 9:100102268-100102290 TTTGTGTTTTTAGTAGGGACGGG 0: 70
1: 8140
2: 177829
3: 214352
4: 128371
1058022293_1058022300 -5 Left 1058022293 9:100102251-100102273 CCACAGCCCAGCTAATTTTTGTG 0: 1
1: 23
2: 172
3: 1064
4: 2067
Right 1058022300 9:100102269-100102291 TTGTGTTTTTAGTAGGGACGGGG 0: 41
1: 4561
2: 111108
3: 225411
4: 154539
1058022293_1058022303 18 Left 1058022293 9:100102251-100102273 CCACAGCCCAGCTAATTTTTGTG 0: 1
1: 23
2: 172
3: 1064
4: 2067
Right 1058022303 9:100102292-100102314 TTTCACCATATTGGTCAGGCTGG 0: 2879
1: 33243
2: 148738
3: 165214
4: 140932
1058022293_1058022301 9 Left 1058022293 9:100102251-100102273 CCACAGCCCAGCTAATTTTTGTG 0: 1
1: 23
2: 172
3: 1064
4: 2067
Right 1058022301 9:100102283-100102305 GGGACGGGGTTTCACCATATTGG 0: 45
1: 4323
2: 51718
3: 141162
4: 139802
1058022293_1058022302 14 Left 1058022293 9:100102251-100102273 CCACAGCCCAGCTAATTTTTGTG 0: 1
1: 23
2: 172
3: 1064
4: 2067
Right 1058022302 9:100102288-100102310 GGGGTTTCACCATATTGGTCAGG 0: 1733
1: 23205
2: 117790
3: 178002
4: 179771

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058022293 Original CRISPR CACAAAAATTAGCTGGGCTG TGG (reversed) Intronic
Too many off-targets to display for this crispr