ID: 1058026738

View in Genome Browser
Species Human (GRCh38)
Location 9:100148360-100148382
Sequence CATTTTATGCAAAAATTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058026736_1058026738 10 Left 1058026736 9:100148327-100148349 CCTCTTTATATTATTTTTTGAAC 0: 1
1: 0
2: 5
3: 69
4: 929
Right 1058026738 9:100148360-100148382 CATTTTATGCAAAAATTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058026738 Original CRISPR CATTTTATGCAAAAATTTTA AGG Intronic
No off target data available for this crispr