ID: 1058035876

View in Genome Browser
Species Human (GRCh38)
Location 9:100252101-100252123
Sequence ATACATATGAATAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 363}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058035876 Original CRISPR ATACATATGAATAGGAAGGA AGG Intronic
900574395 1:3375873-3375895 GAAAATAGGAATAGGAAGGAAGG + Intronic
903043336 1:20548604-20548626 AGACATCTAAATAGAAAGGATGG + Intergenic
904099605 1:28013368-28013390 ATAATTATGAATAAGAAAGAGGG - Intronic
905163252 1:36056225-36056247 ATATATATGCATATGAAGTATGG - Exonic
905722378 1:40216558-40216580 ATACCTATGACTAGTAAAGAGGG + Intronic
906576707 1:46897819-46897841 GAAAATATGAACAGGAAGGATGG + Intergenic
906595211 1:47069766-47069788 GAAAATATGAACAGGAAGGATGG - Intronic
908570679 1:65406753-65406775 ATATTTTTGCATAGGAAGGATGG + Intronic
910017391 1:82543798-82543820 ATGCATTTAAATAGGAAAGAAGG + Intergenic
912170793 1:107097012-107097034 AGACCAATGAACAGGAAGGAAGG - Intergenic
913076574 1:115345196-115345218 ATAGAAATAAACAGGAAGGAGGG - Intergenic
913316347 1:117556881-117556903 GTACATATCAACAGGAATGACGG - Intergenic
914353284 1:146858748-146858770 ATACATATAATTAGGTGGGAGGG + Intergenic
916076709 1:161204437-161204459 ATAAATCTGAATAAGAATGATGG - Intronic
916966534 1:169950437-169950459 AGACATATGAAGAAGAAGCAGGG + Intronic
917101141 1:171446577-171446599 ATTCATAAGAATTGGGAGGATGG + Intergenic
917439305 1:175052755-175052777 AAATATAAGAATAGAAAGGAAGG + Intergenic
918253854 1:182730120-182730142 AAAGATATGAAAAGGAAGGTTGG - Intergenic
918598625 1:186324794-186324816 ATAAATAGGAAAAAGAAGGAAGG + Intronic
919335577 1:196227325-196227347 AGATATATGAATAGGAAAGATGG + Intronic
919447641 1:197728906-197728928 ATACATTTAGATAGGTAGGATGG - Intronic
920129728 1:203722765-203722787 ATACCTAGGAAAAGGAATGAAGG + Intronic
921694597 1:218193434-218193456 ATAGATATGAATAGCTAGAAGGG + Intergenic
921912681 1:220567890-220567912 ATACAAATGGATAGAAAGCAGGG - Intronic
921940837 1:220837797-220837819 ATAGATAGAAATAGGAAGTAAGG + Intergenic
922652923 1:227356538-227356560 ATCCAGAAGAATAGGAATGAGGG + Intergenic
923794228 1:237137657-237137679 ATCCATTTGAATAAGTAGGAAGG + Intronic
924265863 1:242281170-242281192 TTACAAATGAATCGTAAGGATGG + Intronic
1063539035 10:6913524-6913546 ATAGATATGAATATGGATGAAGG + Intergenic
1063841961 10:10082432-10082454 ATATATATGCATAGGTATGAAGG - Intergenic
1064737921 10:18401947-18401969 ATACATCGGAATCGGATGGACGG - Exonic
1065142357 10:22730577-22730599 AGACATATGATTAGGAAGGAAGG - Intergenic
1065539997 10:26754408-26754430 ACACATATTAACAGTAAGGATGG + Intronic
1065834195 10:29642036-29642058 CTAGACAGGAATAGGAAGGATGG - Intronic
1066142472 10:32520228-32520250 ATACATATCAATAGGATTGCTGG + Intronic
1066779792 10:38931797-38931819 ATAAAGAGGAAAAGGAAGGAAGG + Intergenic
1070323058 10:75369248-75369270 ATACATAATTATAGTAAGGAGGG - Intergenic
1071269943 10:83997865-83997887 ATAAATATGTCTAGGAAGCATGG + Intergenic
1072169552 10:92846666-92846688 TTCCAGATTAATAGGAAGGAGGG + Intronic
1072932895 10:99682639-99682661 ATATATGTGAACAGAAAGGAGGG - Intronic
1073169356 10:101490275-101490297 ATAAAACTGAAAAGGAAGGAAGG - Intronic
1073464893 10:103688861-103688883 AAATAAATAAATAGGAAGGAAGG - Intronic
1073587798 10:104727423-104727445 AAACAGAAGGATAGGAAGGAGGG - Intronic
1074605602 10:114961481-114961503 ATGCTTAAGAATAGGAAGAAAGG - Intronic
1074687190 10:115971963-115971985 AGACATTTGAAATGGAAGGAAGG + Intergenic
1077652917 11:3990447-3990469 ATACATATGAATAGAATTGCTGG + Intronic
1078123387 11:8533825-8533847 ATACATAGCAAAAGGAAAGAAGG + Intronic
1078526088 11:12102596-12102618 ACACTTATAAATAGGAGGGAAGG + Intronic
1079806669 11:24939534-24939556 CTAAATATTCATAGGAAGGAAGG + Intronic
1080117309 11:28635459-28635481 ATAAATATGTATTGGAAGGAAGG + Intergenic
1080825319 11:35843817-35843839 ATAAAGATGAAAAGGAGGGAGGG + Intergenic
1081798041 11:45835297-45835319 TTACCATTGAATAGGAAGGATGG - Intergenic
1083045242 11:59728672-59728694 ATACATTGGAATATGGAGGAAGG - Intronic
1085910434 11:80818466-80818488 ATATATATGAATATTATGGAAGG - Intergenic
1086037399 11:82433203-82433225 ATACATAGGAACACAAAGGAGGG - Intergenic
1087124099 11:94606263-94606285 AAACTCATGAATTGGAAGGAAGG + Intronic
1087200622 11:95341191-95341213 AAACAGATGAAGAGAAAGGAGGG - Intergenic
1088064650 11:105701564-105701586 GTTCATATGAATAGGAAACAAGG + Intronic
1089183721 11:116600575-116600597 ATACATATGAACAGGTAGCATGG - Intergenic
1092014450 12:5146525-5146547 ATATATATGAATAGGTAGGTGGG - Intergenic
1093871929 12:24303134-24303156 ATATATACCAAAAGGAAGGAAGG + Intergenic
1096507715 12:52105861-52105883 ATACAGATAAGTAGAAAGGATGG - Intergenic
1096730036 12:53602192-53602214 ATACAAAAGAATACGAACGAGGG + Intronic
1097538023 12:60898524-60898546 ATATATATGAATAAGTAGGATGG + Intergenic
1097910659 12:64965898-64965920 ATACATATCCCTAGGAAGGGGGG - Intergenic
1099054948 12:77827851-77827873 ATTCATATAACTAGGAAGTAAGG + Intergenic
1099563172 12:84205129-84205151 ATACCTATGAACATGAATGATGG + Intergenic
1099771443 12:87063648-87063670 ATACATATGAATGCAAAGAAGGG - Intergenic
1100954058 12:99886464-99886486 ATACATATAAATAGTGAGAAAGG - Intronic
1101006315 12:100404418-100404440 AAACATATGGATAGGTAGAAAGG - Intronic
1101937374 12:109069356-109069378 GTACAGATGAACAGGAAGCAGGG - Intronic
1102022815 12:109695823-109695845 AGAAATATAAATAGGAAGGTAGG - Intergenic
1103007703 12:117435327-117435349 ACACATATGAATAAGACAGAAGG - Intronic
1104189084 12:126460480-126460502 AGAGAGATGAATAGGTAGGAAGG + Intergenic
1104346244 12:128001829-128001851 ATACACATCGACAGGAAGGAGGG + Intergenic
1105447434 13:20469918-20469940 ATAAAAATGAAGTGGAAGGATGG + Intronic
1106286219 13:28320217-28320239 ATACAGACGAACAGAAAGGAGGG + Intronic
1107252467 13:38380429-38380451 ATACAGATTAATAGGCAAGAAGG - Intergenic
1107445704 13:40468621-40468643 ATAGATACAAATAGGATGGATGG - Intergenic
1107580146 13:41774883-41774905 AAAAATCTGAAAAGGAAGGAAGG + Intronic
1107836673 13:44417236-44417258 ATACATATGCATATGTAAGAGGG - Intergenic
1108826025 13:54413607-54413629 ATATATATATATATGAAGGATGG + Intergenic
1108845059 13:54668167-54668189 ATAAATAAGAATAGTGAGGAAGG - Intergenic
1108915064 13:55598444-55598466 AATAATATGAATATGAAGGATGG - Intergenic
1109323039 13:60833373-60833395 TTTCATAGGAATAGGAAGAATGG + Intergenic
1109844533 13:67969398-67969420 GTACAGAAGAAAAGGAAGGAAGG - Intergenic
1110941902 13:81361917-81361939 ATACATATGAGTGTGAAGGGTGG + Intergenic
1111059820 13:83001593-83001615 ATACATATGCATATAAAGAAGGG - Intergenic
1112274198 13:98001172-98001194 ATAGAAATAAAAAGGAAGGATGG - Intronic
1112393696 13:99008913-99008935 CAACATATGAATAGGGAGGTAGG + Intronic
1112993717 13:105546395-105546417 ATACATAGGAGTATGAAGAAAGG - Intergenic
1114937332 14:27557191-27557213 ATACATATGAACACAAAGAAGGG + Intergenic
1115108758 14:29794706-29794728 ATACATATACATAGGGAGCACGG - Intronic
1115173219 14:30531869-30531891 AGACAGAAAAATAGGAAGGAAGG + Intergenic
1115315645 14:32022133-32022155 ATACATATATATATGAAAGAAGG + Intergenic
1115706131 14:35999961-35999983 ATCCATTTGGATGGGAAGGAAGG - Intergenic
1116241512 14:42349213-42349235 ATAAATATGAATTGAAAGGCAGG - Intergenic
1116481789 14:45399755-45399777 ATCCTGATGAATAGGCAGGATGG + Intergenic
1116627386 14:47282775-47282797 ATACATGTGAATATTAAGAATGG + Intronic
1117301814 14:54437631-54437653 ATAAATATTAACTGGAAGGAGGG + Intronic
1118327598 14:64792119-64792141 AGACATATGAAGGGGAGGGAGGG + Intronic
1118420048 14:65592451-65592473 ATACAGATAGATAGGAAGGTAGG - Intronic
1120159442 14:81129876-81129898 ATACAGATGATTAGGGAAGAAGG - Intronic
1120597041 14:86453226-86453248 ATATAAATGAAGTGGAAGGAGGG + Intergenic
1120667601 14:87325333-87325355 TTATATATGAATACCAAGGATGG + Intergenic
1121784058 14:96641387-96641409 AAACATATGAGGAGGATGGAAGG - Intergenic
1202847487 14_GL000009v2_random:193406-193428 ATCCATATGAATTGGTAGGAAGG + Intergenic
1202916954 14_GL000194v1_random:183964-183986 ATCCATATGAATTGGTAGGAAGG + Intergenic
1202937469 14_KI270725v1_random:104443-104465 ATAAAGAGGAAAAGGAAGGAAGG - Intergenic
1124686878 15:31790490-31790512 ATAAAAAAGAAGAGGAAGGAAGG + Intronic
1125427960 15:39568467-39568489 AAACATATGAATTGGTAGCAGGG + Intergenic
1126949678 15:53867715-53867737 AATCATATTAATAGGCAGGAAGG - Intergenic
1128850471 15:70950001-70950023 ATACACATGAATACAAAGAAGGG - Intronic
1128958000 15:71970228-71970250 TTACATATGAATAGGATGTTAGG - Intronic
1128971844 15:72114958-72114980 ATCCAAATGATTAGGAAAGATGG + Intronic
1129074530 15:72981553-72981575 AGACAGCTGAATAGGAAGCAGGG + Intergenic
1129571064 15:76684070-76684092 ATAAATATGAATAGGAAAGATGG + Intronic
1129920411 15:79314849-79314871 CTGCATATGAAAGGGAAGGAGGG - Intronic
1130140317 15:81220805-81220827 AAAAAAATGAAAAGGAAGGAAGG + Intronic
1132075711 15:98818188-98818210 CTACATATGAATTGGCAGGGTGG + Intronic
1132204538 15:99977335-99977357 ATATATATGAAGAGGAGGGACGG - Intronic
1133812494 16:9171499-9171521 ATACATATAAATAGGTAGGATGG + Intergenic
1134421710 16:14098109-14098131 ATACCTAGGAGTAGGATGGATGG + Intronic
1141304831 16:82852439-82852461 ATCCATGGAAATAGGAAGGAAGG - Intronic
1144062499 17:11596502-11596524 ATACATAAAAATAGGAACAAAGG - Intergenic
1144255940 17:13467175-13467197 ATATATATATATAGGAAGGAAGG - Intergenic
1144256029 17:13469494-13469516 GTATATATATATAGGAAGGAAGG + Intergenic
1144335662 17:14266986-14267008 ATGCATATGAGGAGGAAGGAAGG - Intergenic
1145709101 17:26952488-26952510 ATAAAGAGGAAAAGGAAGGAAGG + Intergenic
1146438598 17:32874275-32874297 AGACAGATAAAGAGGAAGGAAGG - Intronic
1146528588 17:33588503-33588525 ATAAATATGGATCGGAAGAATGG - Intronic
1147529101 17:41257047-41257069 ATACATATGAACACAAAGAAGGG - Intergenic
1149853765 17:60060149-60060171 TTAAATATGTATAGGAAGAAGGG - Intronic
1150527916 17:65943099-65943121 ATAGATATGAATAGATAGGCAGG + Intronic
1151316260 17:73324397-73324419 ATACATGTGGATGGGAAGGGCGG - Intergenic
1152003227 17:77660345-77660367 AAAGATAAGAAAAGGAAGGAAGG - Intergenic
1152145309 17:78564817-78564839 ATACAAATGAATATGAGGGAAGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153759144 18:8313343-8313365 ATACACTTTAATTGGAAGGAAGG + Intronic
1154221796 18:12461393-12461415 ATACATGTGTATAGGTAAGAGGG - Intronic
1154352197 18:13593597-13593619 AGATATATAAATAGGATGGATGG - Intronic
1154371917 18:13771660-13771682 ATACACATGAATACAAAGAAAGG + Intergenic
1155005525 18:21725737-21725759 AGACAGTTGAACAGGAAGGAAGG + Intronic
1155629021 18:27869588-27869610 ATTCATATGAATCTGAATGAGGG + Intergenic
1155721784 18:29022745-29022767 ATACATTTTAATATGAAGGAAGG - Intergenic
1155739398 18:29268680-29268702 ATAAATATTTCTAGGAAGGAAGG + Intergenic
1157144349 18:45146278-45146300 GTACATATGAACACAAAGGAGGG - Intergenic
1158229128 18:55234188-55234210 TTCCAAATGAATAGGAAGGAAGG - Intronic
1159189511 18:65023670-65023692 AAACATATGAACAGGAAGTGAGG + Intergenic
1159547291 18:69855348-69855370 AAACATAGTAATAGAAAGGAAGG + Exonic
1159677965 18:71309741-71309763 GTAGATATGAATAGAAAGGTAGG - Intergenic
1159778191 18:72628366-72628388 ATCCATATGTGTGGGAAGGATGG + Intronic
1159782889 18:72679757-72679779 ATATATATATATAGGAATGAGGG + Intergenic
1162539595 19:11286599-11286621 ATAAATAAAAAAAGGAAGGAAGG + Intergenic
1164335583 19:24316214-24316236 ATACTTCTGAATAAAAAGGAAGG - Intergenic
1165329738 19:35134836-35134858 AGACATACGAACAGGGAGGAAGG - Exonic
1165385343 19:35507252-35507274 ATCCAAATCAAAAGGAAGGAAGG + Intronic
1165714163 19:38033734-38033756 ATACAGCTGAAAAGGAAGGGTGG + Intronic
1165730458 19:38141551-38141573 AGACATAAGGATAAGAAGGAAGG - Intronic
1168323835 19:55526786-55526808 ATGCATATGCATGGAAAGGAGGG - Intergenic
1202674830 1_KI270710v1_random:33580-33602 ATCCATATGAGTTGGTAGGAAGG + Intergenic
926104271 2:10140714-10140736 GTACATATGGATAGAGAGGAAGG + Intergenic
926531246 2:14048855-14048877 ATACATATAAATACAAAGGAGGG + Intergenic
926573589 2:14556267-14556289 AGACATGTGAGTAGGAAGGAAGG + Intergenic
927162588 2:20281866-20281888 ATTCATATATACAGGAAGGATGG - Intronic
927535235 2:23851530-23851552 ATACATATGAAGGGGCAGGCGGG - Intronic
929070460 2:38024299-38024321 ATACACAGGAGTAGGAAGTATGG + Intronic
929781795 2:44961782-44961804 ATTCTTATGAATAGGCAGGATGG + Intergenic
930054518 2:47241620-47241642 AAACATATTAATAGGAGGAAAGG + Intergenic
930600448 2:53436742-53436764 ATACATATTAAAATGAAGGATGG - Intergenic
931041159 2:58302427-58302449 ATATATATAAATTGGAAGGAAGG - Intergenic
931225849 2:60330450-60330472 ATAAATAAAATTAGGAAGGATGG + Intergenic
932247695 2:70209395-70209417 ATTCATATGAATATGAATTATGG + Intronic
932266610 2:70372833-70372855 GTTCATATGATTATGAAGGATGG + Intergenic
932834664 2:75025195-75025217 AAAGATCTGCATAGGAAGGAGGG - Intergenic
934185922 2:89675316-89675338 AGACATCTAAATAGGAAGAATGG - Intergenic
936614541 2:114035094-114035116 ATCCAAAAGAATAGGAAGCAGGG - Intergenic
937235033 2:120425659-120425681 AAACAAAAAAATAGGAAGGAAGG - Intergenic
939058244 2:137388610-137388632 AAACATATAATTAGGTAGGAGGG - Intronic
939695380 2:145316897-145316919 ATATTTAAGAAAAGGAAGGAGGG + Intergenic
939768242 2:146280716-146280738 ATACATAAGATTAGGAAGCTGGG + Intergenic
939910038 2:147970252-147970274 ATACATCACAATAGGAAGAATGG - Intronic
940272257 2:151903963-151903985 ATAAGTATGTATAGGAAAGAAGG + Intronic
940356900 2:152753263-152753285 ATTCTTAGGAATAGGGAGGAAGG + Intronic
940357768 2:152764356-152764378 ATACATGTGTATAGAAGGGAAGG - Intergenic
941105257 2:161344477-161344499 CAACATATGAATAGGAAGGAGGG + Intronic
941531985 2:166681763-166681785 ATTAATATGAATAAGAAGGCTGG + Intergenic
942324518 2:174764694-174764716 AAAAAAATGTATAGGAAGGAAGG + Intergenic
942533885 2:176942404-176942426 ATATATATGTATATGCAGGAGGG + Intergenic
942643660 2:178087808-178087830 ATACTTAGGAGTAGGGAGGAAGG + Intronic
942729079 2:179043827-179043849 AAACAAATGAATAGGAAGAGAGG + Intronic
943702396 2:191000698-191000720 AAACAGATGACTGGGAAGGATGG + Intronic
944434916 2:199677679-199677701 ATACATATATAAAGCAAGGAAGG + Intergenic
944878864 2:203990670-203990692 ATACATTTGAAGAGTAAGGTGGG + Intergenic
945165605 2:206939759-206939781 GTATATATGAGTAGCAAGGAAGG - Intronic
945336184 2:208595391-208595413 CTACGTATGAACAGGGAGGAGGG + Intronic
946118104 2:217481736-217481758 AAACATATTAATGGGAAAGAGGG - Intronic
946260381 2:218485301-218485323 ATATATATTTAAAGGAAGGAAGG - Intronic
947318277 2:228888192-228888214 AGACATATGAAGAAAAAGGAGGG - Intronic
947666759 2:231910851-231910873 AAGCATTTGAAGAGGAAGGAGGG + Intergenic
947683853 2:232062878-232062900 ATCCATGTGAAAAGGAAGGAAGG - Intronic
948184771 2:236012306-236012328 TTACATATAAATAGGCAGAATGG - Intronic
948249639 2:236515602-236515624 AAACCTATAATTAGGAAGGAAGG - Intergenic
1170128324 20:12990123-12990145 ATACATATGAATAAGACACAGGG + Intergenic
1170498014 20:16945753-16945775 ATACCTAGGAATAGAAAGGCTGG + Intergenic
1172196190 20:33093310-33093332 ATACAAATGAATGGGAGGGTGGG - Intronic
1172302421 20:33859491-33859513 ATACAGCTGAGCAGGAAGGAAGG - Intergenic
1172701040 20:36853912-36853934 TTCCATGTGAACAGGAAGGAAGG + Intronic
1173089004 20:39952442-39952464 ACACACAAGAAAAGGAAGGAGGG + Intergenic
1173574414 20:44102221-44102243 ATACACATGAACACAAAGGAGGG + Intergenic
1174696898 20:52568971-52568993 AGACAAAAGAAAAGGAAGGAAGG - Intergenic
1176637107 21:9256601-9256623 ATCCATATGAGTTGGTAGGAAGG - Intergenic
1176950693 21:15042882-15042904 TGACATATTACTAGGAAGGAAGG - Intronic
1177230430 21:18313412-18313434 ATATATATTAATAGAAAGTATGG - Intronic
1177571875 21:22897747-22897769 AGAGATATGCATAGGAAAGAAGG - Intergenic
1178874340 21:36401695-36401717 ATATATATGAATAGTAATGCCGG + Intronic
1179786534 21:43733497-43733519 AGACAGATGGAGAGGAAGGACGG - Intronic
1180542849 22:16467768-16467790 AGACATCTAAATAGGAAGAATGG + Intergenic
1180846783 22:18987316-18987338 ATACATATAAATAAGTAGGCTGG + Intergenic
1182141198 22:27959943-27959965 ATCCATATGCAAAGGAAGGAAGG + Intergenic
1182918826 22:34060755-34060777 ATAGACATGAAGAGGAAGAAGGG - Intergenic
1183759928 22:39806849-39806871 AGACAAATGAATAGGAATGGAGG + Intronic
949792318 3:7806611-7806633 ATGTAAATGAATTGGAAGGATGG - Intergenic
951073924 3:18366292-18366314 ATACAAAGGAAAAGGAAGCAGGG - Intronic
951518064 3:23583879-23583901 ATGCATTCGAATAGGAAGGGAGG - Intronic
952676029 3:36031064-36031086 AAACATATGATTAGCAGGGATGG - Intergenic
952777434 3:37060034-37060056 ATGCACATAAATAGGAATGATGG - Intronic
953485361 3:43289395-43289417 AAGCATTTGAAAAGGAAGGAGGG + Intronic
953747419 3:45585764-45585786 ATCCATAGTAACAGGAAGGAAGG - Intronic
955001258 3:54929757-54929779 AAACAGATGGATAGGAAGGAGGG - Intronic
955998139 3:64699439-64699461 ACTCACATGATTAGGAAGGATGG + Intergenic
956257435 3:67298587-67298609 ATACATAAGAAGAGTAGGGAAGG + Intergenic
956317472 3:67954377-67954399 ATAAATATGAAAATGGAGGAAGG + Intergenic
957103790 3:75860344-75860366 ATCCATATGAGTTGGGAGGAAGG + Intergenic
957175555 3:76803422-76803444 ATACAAAAGAGGAGGAAGGATGG + Intronic
957218422 3:77351094-77351116 AAACAAACAAATAGGAAGGAAGG - Intronic
957753942 3:84462495-84462517 ATACATATGTATAGGTATAAAGG + Intergenic
957799161 3:85052111-85052133 AGACATATGATTTGGAATGAGGG - Intronic
957951858 3:87137544-87137566 ATACATATAAATGGGAATGTTGG + Intergenic
958542072 3:95490764-95490786 ATAGAGATGAATAGGTAGGTAGG + Intergenic
958638186 3:96772411-96772433 ATAAATTTGAATAGAATGGAAGG + Intergenic
958664090 3:97111485-97111507 CTACAGATAAATTGGAAGGAAGG + Intronic
959668823 3:108951356-108951378 ATACATATGGATAGGAAAAAGGG - Intronic
959942604 3:112095267-112095289 ATTGATATGAATAGGAAGTATGG - Intronic
960253638 3:115486664-115486686 ATAAATATGAATCGGAAGAAAGG - Intergenic
960551821 3:118984469-118984491 ATACATATGAATTGGGAGTAGGG + Intronic
960758398 3:121045823-121045845 GTAAATATTAATAGGAAGAAAGG - Intronic
961072391 3:123945637-123945659 GTAAATATGAATGGGAATGAGGG - Intronic
961142916 3:124570340-124570362 ATACAAATGAAGAGGATTGAAGG - Intronic
962799840 3:138880966-138880988 ATACATATGGAAAGTAAGGCTGG + Intergenic
962815696 3:138996143-138996165 ATAAAGCTGAAGAGGAAGGAGGG - Intergenic
963314347 3:143743164-143743186 AGACAGACCAATAGGAAGGAAGG + Intronic
963641009 3:147861832-147861854 ATACATGTGAATGGAAAGGTGGG - Intergenic
965668023 3:171116946-171116968 CTACATATGCATGAGAAGGAAGG + Intronic
965736425 3:171825412-171825434 GTACATAGGAATAGGATAGAGGG + Intergenic
967265319 3:187686272-187686294 AAACATCTTAATAGGAAAGAGGG - Intergenic
968122128 3:196133133-196133155 ATACATATGAATTATAAGGAAGG - Intergenic
968162133 3:196435256-196435278 AAGAATATGAATATGAAGGATGG + Intergenic
1202749787 3_GL000221v1_random:148418-148440 ATCCATATGAGTTGGTAGGAAGG + Intergenic
969240956 4:5897189-5897211 AGAGATTTGAAGAGGAAGGAAGG + Intergenic
970322341 4:14887084-14887106 AAACATATGAATATGCAAGAAGG + Intergenic
970328507 4:14954302-14954324 ATAATGATGAATAAGAAGGAAGG - Intergenic
971673275 4:29592115-29592137 AAACATATAAATAAGAATGAGGG + Intergenic
972256167 4:37357981-37358003 ACAAGTATGAATAGGGAGGAGGG + Intronic
972906910 4:43761164-43761186 ATCCATTTGAATAGAAAGTAGGG - Intergenic
973057285 4:45676961-45676983 CTAAATATGAATAGGAAAGAAGG - Intergenic
974056657 4:56990103-56990125 TTTCATTTGAATAGGACGGAGGG - Intronic
974186718 4:58456718-58456740 TTACATGTGAATAAGCAGGAGGG - Intergenic
974348745 4:60716828-60716850 TTACATATGAAAAGGCAAGATGG + Intergenic
974684777 4:65213341-65213363 ATATATATTTATAGGAAGGAAGG - Intergenic
974967851 4:68785412-68785434 ATACATTTGAAAAGAAATGATGG - Intergenic
975002993 4:69248754-69248776 ATACATTTGAAAAGAAAGGATGG - Intergenic
975011273 4:69356110-69356132 ATACATTTGAAAAGAAAGGGTGG - Intronic
976164759 4:82242391-82242413 GTTCATAGGAATGGGAAGGAAGG + Intergenic
976746489 4:88408167-88408189 GTAAATATGAATGGTAAGGAGGG + Intronic
977007861 4:91594531-91594553 ATGCATTTGGATCGGAAGGATGG - Intronic
977076662 4:92460978-92461000 ATACATATGAGGAAGAAGGGAGG - Intronic
977309661 4:95369804-95369826 ATATGAATAAATAGGAAGGACGG + Intronic
977470837 4:97439458-97439480 AAAAATATGAATAGGATAGAGGG - Intronic
977607551 4:98997122-98997144 AAAAATATGAATAAGAATGAAGG + Intronic
977948346 4:102940030-102940052 AGACATCTAAATAGGAAGAATGG + Intronic
978853425 4:113365882-113365904 ATCCATTTTAATAGGATGGAAGG - Intronic
979476257 4:121160965-121160987 ATACAGGTGAATAAGAAAGAAGG + Intronic
980161356 4:129167469-129167491 ATAAATATGAATAGAAATAAAGG - Intergenic
980836901 4:138205743-138205765 ATAAATAAGAATATGAATGAGGG + Intronic
981587106 4:146315940-146315962 ATAAATATTTATTGGAAGGAGGG - Intronic
981745510 4:148048851-148048873 ATGCGTATGAATAGGAAGCTGGG - Intronic
984842508 4:184081194-184081216 ATATATATGAGAATGAAGGAAGG + Intergenic
1202751998 4_GL000008v2_random:15028-15050 ATCCATATGAGTTGGTAGGAAGG - Intergenic
986487700 5:8255978-8256000 ATATATATATATAGGAAAGATGG + Intergenic
986811441 5:11363867-11363889 ATATATATCATTAGGAAAGAAGG + Intronic
986895972 5:12368639-12368661 ATACATATCATTATGAAAGATGG - Intergenic
987032960 5:13992369-13992391 AGACATAAGAATGAGAAGGAAGG + Intergenic
987943103 5:24567861-24567883 ATACATAGTTATAGGAAGAAGGG - Intronic
988465498 5:31487333-31487355 ATACATGTGAAAATGAAGGAAGG + Intronic
988865795 5:35333171-35333193 ATACATATGGATGGGAAGCTAGG - Intergenic
990034604 5:51304470-51304492 ATAAATAAGAATAGAAATGAGGG + Intergenic
990857522 5:60286627-60286649 AAACATATGAATAAAAATGAAGG - Intronic
991980208 5:72222471-72222493 ATACATTTGTAGAGGAATGAGGG + Intronic
992116164 5:73540463-73540485 ATACTTATGAAAAGGAAGGGAGG + Intergenic
993040349 5:82807405-82807427 ATAAATATAACTAGGAAAGAGGG - Intergenic
993795732 5:92265682-92265704 ATATAGATGGATGGGAAGGAAGG + Intergenic
993823698 5:92654207-92654229 ATATATATGAATGGAAATGAGGG - Intergenic
994064420 5:95520467-95520489 ATAGGAAAGAATAGGAAGGAAGG - Intronic
994577263 5:101594647-101594669 ATACATGGGAATAAGAAAGATGG + Intergenic
994716668 5:103329711-103329733 CAACATATGAATATGGAGGAGGG + Intergenic
994805046 5:104434969-104434991 ATACATATGAATACATAAGAAGG + Intergenic
995716615 5:115087058-115087080 ATACATAGGACTAGAAATGAAGG + Intergenic
995986639 5:118184175-118184197 ATAGATATGAGGAGGAAGCATGG + Intergenic
997034318 5:130169797-130169819 AAACATATGAATTAGAAAGAAGG + Intronic
998576421 5:143322693-143322715 ATTCATATCAATATAAAGGAAGG + Intronic
999340734 5:150768903-150768925 ATACATATACATAGAAAGCATGG + Intergenic
999681725 5:154066620-154066642 ATATATATAGAAAGGAAGGAAGG - Intronic
999861649 5:155654183-155654205 ATACACAGGAGTAGGAAGAATGG - Intergenic
999951011 5:156650528-156650550 ATACACATGAATATGAAGATGGG - Intronic
1002505997 5:179679476-179679498 ATACATATGCAGATGAAGGACGG + Intronic
1003725495 6:8757898-8757920 ATATGTATGAAGAGGAAGGCAGG + Intergenic
1005239934 6:23812544-23812566 CAACATATGAATTGGGAGGAAGG + Intergenic
1007019368 6:38503928-38503950 AAGCAAATGAATAGAAAGGATGG - Intronic
1008466110 6:51832617-51832639 AAAAATATGAATTGGAAAGATGG + Intronic
1008908740 6:56709908-56709930 CTACATATGAGTTGCAAGGAAGG + Intronic
1009737655 6:67698436-67698458 ATACATATATATATGGAGGATGG + Intergenic
1009810836 6:68664314-68664336 CAACATATGAATTTGAAGGATGG - Intronic
1010987687 6:82443838-82443860 ACACATTTCAAAAGGAAGGATGG - Intergenic
1012347497 6:98208723-98208745 ACACATATGAATAAAAAGAATGG - Intergenic
1014882160 6:126736508-126736530 AGAGATGTGAAGAGGAAGGAAGG + Intergenic
1015864109 6:137710603-137710625 ACACACAGGAAGAGGAAGGAAGG + Intergenic
1015993401 6:138972125-138972147 ATACAAAAGGATAGGCAGGAGGG + Intronic
1016170920 6:141015559-141015581 ATGGAGAGGAATAGGAAGGATGG + Intergenic
1016506105 6:144781145-144781167 GTACACATGAAGAGTAAGGATGG + Intronic
1016824321 6:148374282-148374304 AGGAATATGAATGGGAAGGAGGG + Intronic
1018425939 6:163680556-163680578 AAATAAATAAATAGGAAGGAAGG - Intergenic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1022431818 7:30331318-30331340 AAACAGATGAATAGGAAATATGG + Intronic
1024011950 7:45274786-45274808 ACACACATGCAAAGGAAGGAAGG - Intergenic
1024197970 7:47078571-47078593 ATACATACAAACACGAAGGATGG + Intergenic
1024268231 7:47622691-47622713 ATACATGTAGAGAGGAAGGAAGG - Intergenic
1024663395 7:51520999-51521021 ATACAAATGAAAAGCAAGGCAGG - Intergenic
1026213942 7:68331650-68331672 ATACCTCTGAAAAGGTAGGACGG + Intergenic
1026238967 7:68555246-68555268 ATATATAATAATAGAAAGGATGG - Intergenic
1026625546 7:71988779-71988801 CTACATGGGAATAGGAGGGAGGG + Intronic
1030623443 7:111817406-111817428 ATCCATAATAACAGGAAGGAAGG - Intronic
1030821507 7:114098228-114098250 AGACATATGAACATGAAGGAGGG + Intronic
1031403186 7:121350509-121350531 ATACAAACAAATATGAAGGATGG - Exonic
1031555816 7:123174796-123174818 ATACATAGGAAGAAGAAGGGTGG - Intronic
1033735571 7:144218332-144218354 ATAAAGATGAATAGGAAGGGAGG + Intergenic
1033747483 7:144332638-144332660 ATAAAGATGAATAGGAAGGGAGG - Intergenic
1034036400 7:147827946-147827968 AATCATAAGAATAGGAAGAATGG - Intronic
1034143880 7:148851145-148851167 ATAGGTATGAAAAGGAAGGGTGG + Intronic
1035994784 8:4533387-4533409 ATCCATATGACCAGGATGGACGG + Intronic
1036260696 8:7237493-7237515 AGCCATATGAATAGGAAGAGAGG - Intergenic
1036312734 8:7696049-7696071 AGCCATATGAATAGGAAGAGAGG - Intergenic
1038095445 8:24304524-24304546 ATGTATATGAAAAGCAAGGAAGG + Intronic
1038100770 8:24371872-24371894 ATACATATTAATAGGAATAATGG + Intergenic
1038126815 8:24683580-24683602 ATAAATATGAATACGTATGATGG + Intergenic
1038755417 8:30336104-30336126 AGACAAAGAAATAGGAAGGAAGG + Intergenic
1038833163 8:31085856-31085878 ATACACATGAATTGGAAGAAAGG - Intronic
1039269354 8:35863820-35863842 ATACAAAGGAATAAGCAGGATGG - Intergenic
1040478260 8:47800030-47800052 ATTCAAATAAATAGGAAGCACGG + Intronic
1041881218 8:62751556-62751578 ATACATAAGAATAAAAAGAAGGG - Intronic
1042116746 8:65440581-65440603 ATAAAAATGAGTAGAAAGGAAGG - Intergenic
1042267457 8:66923983-66924005 GTACCTATGAATAGGAAGCAGGG + Intergenic
1043012101 8:74893767-74893789 ATATAAATGCATAGGATGGATGG + Intergenic
1045650675 8:104339059-104339081 TTTCATTTGAACAGGAAGGATGG - Intronic
1046627763 8:116593421-116593443 ATACAGATGAAAAAGAAGGCTGG - Intergenic
1048227619 8:132603945-132603967 ATTCATAGAATTAGGAAGGAAGG + Intronic
1049937606 9:514275-514297 ATTGAGATGAATAGGAAGGAAGG - Intronic
1052293189 9:26867445-26867467 ACAGATATGAATAGGTGGGATGG - Intronic
1052438764 9:28465595-28465617 ATTGATATGAACAGGAAGCAGGG - Intronic
1052595291 9:30550341-30550363 CAACATATGAATTGGAAGGAGGG - Intergenic
1052783142 9:32801717-32801739 ATGCACATAAATAGTAAGGAGGG + Intergenic
1055594942 9:77856383-77856405 ATATATTTCTATAGGAAGGAAGG + Intronic
1056035915 9:82605313-82605335 ATACATATGACTTGGCTGGAGGG - Intergenic
1058035876 9:100252101-100252123 ATACATATGAATAGGAAGGAAGG + Intronic
1058172945 9:101705001-101705023 ATACATTTGATAAGGAAGGGGGG + Intronic
1058331568 9:103767910-103767932 TGACATATGAATTTGAAGGAGGG - Intergenic
1058605771 9:106721172-106721194 ATAGATATTTATAGGAAAGAGGG - Intergenic
1059851674 9:118348015-118348037 ATAGATAAGAATAGGAATGATGG - Intergenic
1060333763 9:122702019-122702041 ACAAAAATGAATAGGAAGGGAGG + Intergenic
1061294087 9:129667574-129667596 AGACAGAGGAAGAGGAAGGAAGG + Intronic
1203386396 Un_KI270438v1:59582-59604 ATACAATTGAATAGAATGGAAGG + Intergenic
1203718430 Un_KI270742v1:178505-178527 ATCCATATGAGTTGGTAGGAAGG + Intergenic
1203652644 Un_KI270751v1:142200-142222 ATCCATATGAGTTGGTAGGAAGG + Intergenic
1185938016 X:4281044-4281066 AGACATATGAAAAGGTAGGCGGG - Intergenic
1186529366 X:10279685-10279707 ATGTTTATGAAAAGGAAGGAGGG - Intergenic
1186997565 X:15140012-15140034 ATAAAGATGAATAAGCAGGAGGG + Intergenic
1187035567 X:15535728-15535750 ATATATAGAAAAAGGAAGGAGGG + Intronic
1187802270 X:23076700-23076722 ATACAAACAAATATGAAGGATGG + Intergenic
1189631301 X:42956489-42956511 TGACATATGAATTGGGAGGAGGG + Intergenic
1192845330 X:74901385-74901407 AAACATATAAATAGCCAGGATGG + Intronic
1193379746 X:80805354-80805376 ATACATATGAACAAAAAGGCAGG + Intronic
1194103030 X:89731015-89731037 AGACACATGAATAGGCAGAATGG - Intergenic
1195280245 X:103326495-103326517 ATACATATGAACACAAAGAAAGG + Intergenic
1195996058 X:110732673-110732695 AGACAGATGGCTAGGAAGGATGG + Intronic
1196293749 X:113976299-113976321 AGGCATATTAATAGGAAGGAAGG - Intergenic
1196615887 X:117766840-117766862 AAACACATGAAGAGGAAGAAGGG + Intergenic
1197189237 X:123627188-123627210 ATTCATATGAATAGTTATGATGG - Intronic
1197512119 X:127382549-127382571 ATACATCTAAATAGGAAGAGAGG - Intergenic
1198325630 X:135569417-135569439 ATACATACTAATAGGTAGTATGG - Exonic
1199857975 X:151775993-151776015 ATACATATGCAAAGAAAGGTGGG + Intergenic
1200390444 X:155939972-155939994 ATAATTCTCAATAGGAAGGAGGG - Intronic
1200455267 Y:3383015-3383037 CTAAATATGAGTAGAAAGGAGGG - Intergenic
1200455716 Y:3389038-3389060 AGACACATGAATAGGCAGAATGG - Intergenic
1201172580 Y:11283355-11283377 ATCCATATGAGTTGGTAGGAAGG + Intergenic
1201183738 Y:11376703-11376725 AGACATCTAAATAGGAAGAATGG + Intergenic
1201683530 Y:16676324-16676346 ATAAAGATGAATTGGATGGATGG + Intergenic
1201722688 Y:17118701-17118723 ATAGATATGGATAGACAGGAAGG + Intergenic
1202231807 Y:22666344-22666366 ATACAGAAAAATAAGAAGGAAGG - Intergenic
1202311351 Y:23529821-23529843 ATACAGAAAAATAAGAAGGAAGG + Intergenic
1202559451 Y:26140773-26140795 ATACAGAAAAATAAGAAGGAAGG - Intergenic