ID: 1058037107

View in Genome Browser
Species Human (GRCh38)
Location 9:100264890-100264912
Sequence TGCTGCTTTCCCTAATCAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058037106_1058037107 -1 Left 1058037106 9:100264868-100264890 CCATTAAATTACTGCTAGACTTT 0: 1
1: 0
2: 1
3: 18
4: 216
Right 1058037107 9:100264890-100264912 TGCTGCTTTCCCTAATCAGATGG 0: 1
1: 0
2: 1
3: 13
4: 164
1058037105_1058037107 7 Left 1058037105 9:100264860-100264882 CCTTGATGCCATTAAATTACTGC 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1058037107 9:100264890-100264912 TGCTGCTTTCCCTAATCAGATGG 0: 1
1: 0
2: 1
3: 13
4: 164
1058037104_1058037107 23 Left 1058037104 9:100264844-100264866 CCTGCAACAATGGATACCTTGAT 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1058037107 9:100264890-100264912 TGCTGCTTTCCCTAATCAGATGG 0: 1
1: 0
2: 1
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058037107 Original CRISPR TGCTGCTTTCCCTAATCAGA TGG Exonic
901321502 1:8343076-8343098 TGCGGCTTCCCCCCATCAGAAGG - Intronic
901337751 1:8465833-8465855 TTCTGCTTTCCCTGAGCAGCAGG + Intronic
905647960 1:39637635-39637657 AGCTGCTTTCTCTCCTCAGAGGG + Intronic
906644254 1:47462245-47462267 TACTGCTTGCCCTAATAGGATGG - Intergenic
909049702 1:70753149-70753171 TGCAGCTTCCCCTAATCCCATGG - Intergenic
910051658 1:82981627-82981649 TGGTGCTTTCCCCTAACAGATGG - Intergenic
913368870 1:118074058-118074080 TGCAGATTTCCCCAATTAGATGG - Intronic
914396536 1:147274809-147274831 TGGAGTTTTCTCTAATCAGAGGG + Intronic
921308479 1:213820276-213820298 GCCAGCTTTCCCTAATAAGAAGG - Intergenic
922242718 1:223766605-223766627 ATTTGCTTTCCCTCATCAGAGGG - Intronic
923606703 1:235450499-235450521 TGGTGCTTTCCCAAATCAGGAGG - Intronic
1066779856 10:38932398-38932420 AGCTGCATTCCCTAATTAGTAGG + Intergenic
1069653496 10:70069637-70069659 TTAAGCTTTGCCTAATCAGAGGG + Intronic
1070503858 10:77096180-77096202 AGCTGCTTTCTTTCATCAGAAGG - Intronic
1070916141 10:80156101-80156123 TGCTGCTTTCCGTCTTCTGATGG - Intronic
1071810063 10:89169726-89169748 TGCTGTTTTGGGTAATCAGAAGG - Intergenic
1071873889 10:89823035-89823057 TGCTGCTTTCCAGAAACACAAGG - Intergenic
1076631895 10:131856571-131856593 TGCTCCTTTCCCTCCTCAGGAGG - Intergenic
1079906047 11:26248420-26248442 TAGTTCTTTCCCTAATGAGAGGG + Intergenic
1081643649 11:44775356-44775378 TGCTGCTTTACTTAATAATAGGG + Intronic
1085758352 11:79220133-79220155 GGCTGCCTTCCCTAAACAGGGGG - Intronic
1088402508 11:109436669-109436691 TCCTGCAGTCCCTAATCAGTAGG + Intergenic
1094551874 12:31460247-31460269 TGCTCCTGTCCCTTATCTGATGG - Exonic
1095374360 12:41508415-41508437 TGCTGCTTTCCCCAATTAATAGG + Intronic
1095788919 12:46143199-46143221 TTCTGCTTTTCCTAAGCAGAAGG + Intergenic
1102446667 12:113008317-113008339 TGCTGGTGGCCCTAAGCAGATGG - Intronic
1103243201 12:119432234-119432256 AGTTGCTGTCCCTACTCAGATGG - Intronic
1103699383 12:122840891-122840913 TGCGCCTGTCCCTATTCAGAGGG - Intronic
1107151596 13:37118051-37118073 TGTTGCTTTCCCTGAGCTGAGGG - Intergenic
1107716417 13:43204134-43204156 TGCTGCTTTGGCCAATGAGACGG - Intergenic
1107796582 13:44059257-44059279 TGCTGCCTTCACTCATCAGAAGG - Intergenic
1109824998 13:67707329-67707351 TGCTGTTTTCCAGAATCACAAGG - Intergenic
1110671926 13:78190758-78190780 TTCTACTTTTCCTTATCAGAAGG + Intergenic
1111875512 13:93889261-93889283 TGCTGCTATCTATAATCAGGAGG + Intronic
1113652728 13:112047706-112047728 CTCTGCTTTCCCAACTCAGAGGG + Intergenic
1114254898 14:20993321-20993343 TTCTGCCTTGCCTAATCTGATGG - Intronic
1114255498 14:20998361-20998383 TGCTGATTCCCCTATTCAGGTGG - Intergenic
1116255969 14:42555981-42556003 TGCTGCTTTTCGAGATCAGATGG + Intergenic
1116684000 14:48014737-48014759 TTCTGCTTTCTCTTATCAGCAGG - Intergenic
1117104005 14:52380480-52380502 TGCTGCCTTCCCAAAGCAGAAGG - Intergenic
1117514028 14:56482552-56482574 TGCAGCTTTCCCTACTCTCAAGG + Intergenic
1118105948 14:62659761-62659783 TCCTCCTTTCCCAAAGCAGAAGG - Intergenic
1118244117 14:64091820-64091842 TGCTGCCTTTCCTGATTAGATGG + Intronic
1118328692 14:64799551-64799573 TGCTGGTTTCTCTAAGCTGATGG + Intronic
1118612746 14:67554249-67554271 TTCTGCTTTCCTTAATTAAAAGG - Intronic
1119082575 14:71709608-71709630 TGCTGTTCTCCCTTGTCAGAGGG - Exonic
1124879165 15:33625665-33625687 TTCTCCTTTCCCTATTAAGATGG - Intronic
1125061094 15:35425316-35425338 TGCTGGTTTACCTTTTCAGAAGG + Intronic
1125649437 15:41302635-41302657 TGCTTGTTTCCTAAATCAGAGGG + Intergenic
1126527895 15:49677923-49677945 TGCCTCTGTCCCTATTCAGACGG - Intergenic
1126805861 15:52348649-52348671 TACTGACTTCCCAAATCAGAAGG + Intronic
1131335087 15:91541279-91541301 TGATTCTTTCCCTGCTCAGATGG + Intergenic
1132209459 15:100009212-100009234 TGCTGGTTTCCCTTTACAGAGGG + Intronic
1134010868 16:10851594-10851616 TTCTGCCTTCTCTAAGCAGATGG - Intergenic
1136798769 16:33049488-33049510 AGCTGCTTACCCTAATTAGTAGG + Intergenic
1137428894 16:48402384-48402406 TGCTGCTTTCCCGACTAGGAAGG + Intronic
1137538789 16:49347797-49347819 TCCTGCTTTCCTTTGTCAGAAGG + Intergenic
1137685383 16:50383166-50383188 TGCTCAGTTCCCTAAGCAGAGGG - Intergenic
1139596705 16:67962322-67962344 TGCTGCTTTCCCAGGTCAGGAGG + Intronic
1141589642 16:85059862-85059884 TGCTCTTTTCCCTAATCAGTAGG - Intronic
1142346354 16:89556541-89556563 TGCTGCTCTCCTCAATCAGGAGG + Intronic
1151378262 17:73706714-73706736 TGCCTCTTGCCCTCATCAGATGG - Intergenic
1151788709 17:76290070-76290092 TTCTGCTTTCCATAGTCAAAAGG - Exonic
1151939504 17:77283534-77283556 TGCTGCTTTCCTTAATTTCATGG - Intronic
1203171443 17_GL000205v2_random:151147-151169 TGCTGCTTTCCTTACACAAAAGG - Intergenic
1153275740 18:3365896-3365918 TGCTGACTTCCCACATCAGAAGG - Intergenic
1153477523 18:5513049-5513071 AGCTGCATTCCCTAACCACAGGG - Intronic
1153710885 18:7797658-7797680 TGCTGCTTTCCCACATTTGAAGG - Intronic
1154133333 18:11754795-11754817 GGCTGCTTTTCCTAATCACTTGG + Intronic
1155220902 18:23684853-23684875 TATTGCATTCCCTAGTCAGAGGG - Intergenic
1156714189 18:39987015-39987037 TGCTGGTTCCCCTAAAAAGACGG - Intergenic
1165707925 19:37989607-37989629 TGAGGATTTCCCTATTCAGAGGG - Intronic
1167156046 19:47739905-47739927 CGCTGCTCTCACTCATCAGAGGG + Intronic
1167382772 19:49148399-49148421 TGCTCCTTTCACCAATGAGATGG + Intronic
1168469503 19:56629118-56629140 TGCTGCTCTCCCTCAGCAGGAGG + Intergenic
928932331 2:36637243-36637265 TTCTCCTTTCCTTAAGCAGAAGG - Intronic
929153094 2:38765858-38765880 AGGTGCTTTCCGTGATCAGATGG - Intronic
929891211 2:45919793-45919815 TTCTGCTTTCACTCAGCAGAAGG - Intronic
934720629 2:96573308-96573330 TGCTGCTTGCCCTGACCAGGTGG - Intergenic
935134415 2:100287060-100287082 TGCCTCTTTCCCTGATCAGGTGG - Exonic
937008752 2:118542848-118542870 TGCTTCTGTCCTTAGTCAGAGGG - Intergenic
937644702 2:124253548-124253570 CATTGCTTTCCCTAATCAGCAGG + Intronic
938398150 2:130965611-130965633 TGCCCCTTTCCTTATTCAGACGG + Intronic
940895498 2:159078720-159078742 TGCTGCTTCCAGAAATCAGAAGG - Intronic
941650833 2:168090837-168090859 TGCTACTTTGCTTAAGCAGATGG - Intronic
941741128 2:169036426-169036448 TGCTGGTTTTCCTCATTAGAGGG - Intergenic
945289271 2:208111752-208111774 TACTGGTTTGCCCAATCAGAAGG + Intergenic
945381479 2:209146107-209146129 TACTGGTTTGCCCAATCAGAAGG - Intergenic
945848621 2:214979091-214979113 TGCTCCAGGCCCTAATCAGAGGG + Intronic
946131953 2:217613332-217613354 TGCTGTTTTCCCTTTTAAGATGG - Intronic
946576906 2:221085637-221085659 TGCTGGTATCCCTCACCAGATGG - Intergenic
946933816 2:224698800-224698822 TGGTGTTTTCCATAATCAGCAGG + Intergenic
947292719 2:228595195-228595217 TTCTGCTTTCTCTTAACAGAGGG + Intergenic
1172879643 20:38191195-38191217 TGCTGGTGCCTCTAATCAGATGG - Intergenic
1178726381 21:35055917-35055939 TTCTGGTTTCCATAGTCAGAGGG + Intronic
1180865769 22:19118840-19118862 TGCTGCCTTCTCTACACAGATGG + Intronic
1183795619 22:40114787-40114809 TGCAGCTGTACCTGATCAGATGG + Intronic
949904050 3:8843620-8843642 TGCTGCTGGCCCTACTCAGCTGG - Intronic
951836503 3:26989041-26989063 TGCTGCTTTCCCTTCTCAAGTGG - Intergenic
953633921 3:44645600-44645622 CCCTGCTTTCCCTATTCAGAGGG + Intronic
954956576 3:54526578-54526600 TGCTGCTTTTGCTTTTCAGAGGG + Intronic
956321075 3:67996856-67996878 TGCTACTTTGCCTAATTATATGG + Intergenic
957810456 3:85215003-85215025 TTCTCCTTTCCCTAAGCAGAAGG + Intronic
959611483 3:108300040-108300062 TGCTGCTTTCCCTCCTCAGATGG - Intronic
960576745 3:119237664-119237686 TACTGCTTTTCCTTACCAGAGGG - Intronic
961445561 3:126979424-126979446 TGCTGCAGTCCCTCCTCAGAGGG + Intergenic
962264334 3:133934767-133934789 TGCTGCTTTGCTTCATCAGCTGG - Exonic
963489607 3:145983244-145983266 TGCTGCTTTATGTAAGCAGAAGG - Intergenic
964679227 3:159318768-159318790 AGCAGCATTCCATAATCAGATGG - Intronic
965118983 3:164525654-164525676 TTCAGCTTGGCCTAATCAGAAGG - Intergenic
965346793 3:167561152-167561174 TGCTGCTTTTCATAATCAAATGG + Intronic
967187404 3:186956606-186956628 TTCTGCTTTCCCTAGTCATGAGG + Intronic
970097968 4:12486714-12486736 TTCTGCTTTCCTCAATCAGAAGG + Intergenic
973331424 4:48913600-48913622 TTCTGCTTTCCCTTATGAGCTGG + Intergenic
973335927 4:48956322-48956344 TGTTTCTTTCCTTACTCAGAAGG - Intergenic
974232578 4:59136054-59136076 TGCTGATTTCCCTTACCAGTTGG + Intergenic
976520092 4:86016797-86016819 TGCTCCTTGGCCTAGTCAGATGG - Exonic
976901719 4:90185505-90185527 AGATGCTTTCCCTAATCACAAGG - Intronic
985659701 5:1150963-1150985 TGAGGCTTTCCCCCATCAGAAGG + Intergenic
986646329 5:9920053-9920075 TGCTGTTTCCACTACTCAGATGG - Intergenic
986825792 5:11520736-11520758 TCCTGCTTTCCCCAGCCAGATGG + Intronic
987081439 5:14428811-14428833 TACTGCTTTCCCTAAACACTAGG - Intronic
987088779 5:14492557-14492579 TGCTGCTTTCACTCTGCAGAGGG - Exonic
987400451 5:17470171-17470193 AGCTGCTTTCCCTAATCCAGAGG + Intergenic
989261536 5:39424631-39424653 TGCTGGTTTCCCCAAGCACAGGG + Intronic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
992749803 5:79851288-79851310 CCCTGATTTCCCCAATCAGAAGG - Intergenic
1001046894 5:168380862-168380884 TGGTTCTTTCACTAAGCAGAAGG - Intronic
1001245643 5:170104377-170104399 TGGTGGTCTCCCTACTCAGAGGG - Intergenic
1001680168 5:173550885-173550907 TGCTGCGTTCCCAAGTCAGGAGG + Intergenic
1003127614 6:3368116-3368138 TGCTGCTTTCTGGAAACAGAAGG + Intronic
1004123164 6:12845468-12845490 TGCTGCTTTGCAGCATCAGATGG + Intronic
1006410323 6:33870028-33870050 TGCTGCTCTCCCGCAGCAGAGGG + Intergenic
1007166989 6:39835780-39835802 TGGTGCCTACCCTAATGAGATGG + Intronic
1008211817 6:48733728-48733750 TCCTATGTTCCCTAATCAGAAGG + Intergenic
1008900862 6:56614084-56614106 TGCTGCTTTTCCTAATAATTAGG - Intronic
1010324644 6:74550562-74550584 TTCTCCTCTCCCTAAGCAGAAGG + Intergenic
1014832347 6:126117700-126117722 TCCTTGTTTTCCTAATCAGATGG - Intergenic
1017100026 6:150840333-150840355 TGCTGCTTTCCCACATCACTAGG - Exonic
1019625042 7:2011651-2011673 TGATGCCTTGCCTCATCAGAGGG - Intronic
1019674125 7:2301171-2301193 TGGAGCTTTCCCTCTTCAGATGG - Intronic
1021965156 7:25910856-25910878 TGAACCTTTCCCAAATCAGAAGG + Intergenic
1022684143 7:32578908-32578930 TGCTGCCTTCCCTAATCTTTAGG - Intronic
1023456865 7:40348950-40348972 TGCTTCTTTCCCTACATAGATGG + Intronic
1024336411 7:48211458-48211480 TTCTGTTTCCCCTAATCAGAAGG + Intronic
1028727057 7:94100026-94100048 TACTGCTTTACATAATTAGAAGG - Intergenic
1029802922 7:102968799-102968821 TGCTGCTTTTCATAATAAAATGG + Intronic
1030879499 7:114859836-114859858 TGCTTCTCTTCCTACTCAGAAGG - Intergenic
1035625982 8:1070965-1070987 GGCTGCTTTTCCAAATCAGAAGG + Intergenic
1036237557 8:7053502-7053524 TGCTGCCTTTCCTCATCTGATGG - Intergenic
1037563265 8:20094232-20094254 GGCTGCCTTCTCTATTCAGATGG - Intergenic
1042474300 8:69229171-69229193 TGTTGCTTTCCAAAAGCAGAAGG - Intergenic
1044026173 8:87175287-87175309 TTCTGCTTTTCTTAAGCAGAAGG + Intronic
1044950365 8:97430050-97430072 TGCTTCTTTACCTAATAAAATGG + Intergenic
1046149995 8:110211427-110211449 ATCTGCTTTTCTTAATCAGAGGG - Intergenic
1046614954 8:116466034-116466056 TGCTGTTTTCTCTGATGAGAAGG + Intergenic
1047026949 8:120834793-120834815 TGCTCCTTCCTTTAATCAGAAGG + Intergenic
1047570243 8:126089916-126089938 TGCTGCTTCAAATAATCAGAGGG + Intergenic
1048367632 8:133752432-133752454 CCCTGCTTACCCTAATGAGAAGG - Intergenic
1050248130 9:3713441-3713463 TGCTCCTCTCCTTAAGCAGAAGG - Intergenic
1050357605 9:4797710-4797732 TGCTGCTATTCCTAATCATTAGG - Intronic
1052292245 9:26855787-26855809 AGCTGCTTTCCCTAATGAACTGG + Intronic
1053887064 9:42651689-42651711 ACCTGCTTTCCCTAATCTCATGG + Intergenic
1054226084 9:62459139-62459161 ACCTGCTTTCCCTAATCTCATGG + Intergenic
1055795037 9:79966971-79966993 TGCTGCTGTACCTAATGAAAGGG + Intergenic
1058037107 9:100264890-100264912 TGCTGCTTTCCCTAATCAGATGG + Exonic
1059567708 9:115399797-115399819 TGCTGCTTTCCTTTCTCATAAGG + Intronic
1060085633 9:120697940-120697962 TGCTGCATTGCCAAAGCAGATGG - Intronic
1186984610 X:14998595-14998617 TGCTGGTTACCCTGATCATAAGG - Intergenic
1190507871 X:51145541-51145563 CTCTGCTTTCCCAAAGCAGAAGG + Intergenic
1192074291 X:67975553-67975575 TTCTGCTTTCCATAATGGGATGG + Intergenic
1192329498 X:70163652-70163674 TGCTGCATTCCTTCATCAGGAGG - Intronic
1192812589 X:74560245-74560267 TGCTGCCTGCCCTAGTCAGTGGG - Intergenic
1193419233 X:81263621-81263643 TGCTGTTTTCCATAGTCAGAAGG + Intronic
1193819165 X:86141343-86141365 TTCTCCTATCCATAATCAGAAGG + Intergenic
1193933321 X:87583410-87583432 TTCTCCTTTCCTAAATCAGAAGG - Intronic
1194693345 X:97013663-97013685 TGTTGCTTTCCCTGGTCAAATGG + Intronic
1195870045 X:109475983-109476005 TTCTGCTTTCCCGACACAGACGG + Exonic
1197053900 X:122094220-122094242 TTCTGCTTTTCTTAAGCAGAAGG - Intergenic