ID: 1058038167

View in Genome Browser
Species Human (GRCh38)
Location 9:100275654-100275676
Sequence CCATCCTAACATAATAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058038167_1058038170 3 Left 1058038167 9:100275654-100275676 CCCAGTTTATTATGTTAGGATGG 0: 1
1: 0
2: 1
3: 15
4: 130
Right 1058038170 9:100275680-100275702 AAATCATTTTCCTCAAAATGAGG No data
1058038167_1058038172 13 Left 1058038167 9:100275654-100275676 CCCAGTTTATTATGTTAGGATGG 0: 1
1: 0
2: 1
3: 15
4: 130
Right 1058038172 9:100275690-100275712 CCTCAAAATGAGGATGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058038167 Original CRISPR CCATCCTAACATAATAAACT GGG (reversed) Intronic
903406925 1:23105124-23105146 CCATTCTAGCAGGATAAACTAGG + Intronic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
908428367 1:64031219-64031241 CCATACTAACAAAATTGACTTGG + Intronic
909852456 1:80485718-80485740 GCATCTTAGCATAACAAACTGGG + Intergenic
911025594 1:93433243-93433265 CCATCTCAAAATAAAAAACTGGG + Intergenic
916756250 1:167772776-167772798 ACATCCAAACATAATGAATTTGG - Intronic
917047725 1:170881279-170881301 TCATGCTAACATTTTAAACTAGG - Intergenic
920930697 1:210385134-210385156 CCACCCTAAAAAATTAAACTTGG + Intronic
923371284 1:233316593-233316615 TCATACTGACATAATGAACTGGG + Intergenic
1064279274 10:13936447-13936469 CCATCCTAATATCATCACCTTGG - Intronic
1069488795 10:68843858-68843880 CCAGCCAAAAATAATAAAATAGG - Intronic
1071558220 10:86623241-86623263 ACAACAAAACATAATAAACTGGG - Intergenic
1072531994 10:96328276-96328298 CCATCCTAACAAAATAGGTTTGG + Intronic
1074712295 10:116187516-116187538 CCAAATTAACATAATAATCTAGG + Intronic
1076221649 10:128738603-128738625 CCTTCCTAACATAAATAATTTGG + Intergenic
1082224418 11:49686958-49686980 TTATCCTGACATAATAAATTTGG - Intergenic
1086624626 11:88932256-88932278 TTATCCTGACATAATAAATTTGG + Intronic
1088540987 11:110913374-110913396 CCATCCTACCAGAATGCACTGGG + Intergenic
1092706183 12:11287545-11287567 CATTCTAAACATAATAAACTAGG + Intergenic
1092978074 12:13765074-13765096 CCATGCTAACAAAACAAAATGGG + Intronic
1095129833 12:38527427-38527449 ACATCCTAAAATAATAAAATGGG + Intergenic
1095129987 12:38529579-38529601 ACATCCTAAAATAATAAAATGGG + Intergenic
1096379878 12:51147418-51147440 AGAACCTAACAGAATAAACTTGG - Intronic
1098680789 12:73351199-73351221 CCATTCTAACCTAATAATATTGG - Intergenic
1099865072 12:88269768-88269790 AATTCCTACCATAATAAACTTGG - Intergenic
1106539637 13:30678737-30678759 CCATCCTAAGAAAATAACCAGGG + Intergenic
1110465730 13:75798574-75798596 CCATTCCATTATAATAAACTGGG + Intronic
1113317413 13:109197008-109197030 CCATCCCAAAATAATAATTTTGG + Intronic
1114863629 14:26558863-26558885 CCATCCTAATATAATTATGTAGG - Intronic
1120629631 14:86874312-86874334 CAAACCTCACATAATAAATTAGG + Intergenic
1120774432 14:88417823-88417845 CTATCCTCATAAAATAAACTGGG + Intronic
1125428222 15:39571049-39571071 CCATCCTTCCAAAATATACTTGG + Intergenic
1127495841 15:59511383-59511405 CCATTCTAAAAGAATAAAATTGG + Intronic
1127597689 15:60503230-60503252 TCTTCCTAACATCATAAACTCGG + Intronic
1128127913 15:65206516-65206538 CCACTCAAACATAATAAAATAGG + Intronic
1129485748 15:75870560-75870582 CCCTCATAAGATAATAAACAAGG + Intronic
1129524102 15:76203245-76203267 CCATCCTAACTCAGGAAACTTGG - Intronic
1131544167 15:93302003-93302025 CCATGCTTCCAGAATAAACTAGG - Intergenic
1133604473 16:7372669-7372691 CCATTCTTCCATAATAAATTAGG + Intronic
1137641689 16:50037236-50037258 TAATCATAACCTAATAAACTGGG - Intergenic
1137750288 16:50856623-50856645 CAATTGTAAGATAATAAACTGGG - Intergenic
1139146375 16:64330102-64330124 CCATACTAACACAATAATTTTGG + Intergenic
1141050161 16:80754398-80754420 CCACCCTAACATCATAAATTAGG + Intronic
1144259216 17:13501939-13501961 CCATAATAAGATAATAAGCTAGG - Intronic
1146743968 17:35312099-35312121 ACATCCAAACACAATAAACCTGG - Intergenic
1152834846 17:82522742-82522764 ACATGCTAACATGATAAACATGG + Intronic
1153211794 18:2774798-2774820 CCATCCTAGCACAATGAACTAGG + Intronic
1153588235 18:6645818-6645840 CCACCCTGACTTCATAAACTGGG + Intergenic
1159479460 18:68969157-68969179 CCATGCTAACGTAATGAACTGGG + Intronic
1159903738 18:74072012-74072034 CCATCCCAACATAATTAAACAGG + Intergenic
1160626424 18:80210671-80210693 TCCTACTAACAAAATAAACTTGG - Intronic
1167687197 19:50963680-50963702 CCATCCTTTCAGAATAATCTTGG + Intronic
930110036 2:47670940-47670962 CAAGCCTAAGCTAATAAACTTGG - Intergenic
932146963 2:69329085-69329107 ACATTTTAACATGATAAACTTGG - Intronic
932247825 2:70211303-70211325 CCACCCCAAAATAATAAAATCGG + Exonic
946609585 2:221442847-221442869 CCATCCGAACATCATTCACTTGG - Exonic
946642161 2:221795845-221795867 CCAACCTAACATAATCAAACGGG - Intergenic
946868694 2:224066336-224066358 TCATACTAACATTTTAAACTTGG + Intergenic
947788851 2:232850397-232850419 CCGTGCTCACCTAATAAACTGGG - Exonic
1169666683 20:8045108-8045130 ACATCCTCACATAATTAAATGGG - Intergenic
1178387445 21:32164559-32164581 CCAACTTAACACAGTAAACTGGG + Intergenic
1178519927 21:33280801-33280823 CATTCCTAAGATAATAAACATGG - Intronic
1185196612 22:49474738-49474760 CCCTCCTACCATAAAAGACTTGG + Intronic
951419586 3:22468697-22468719 CGTGCCTAACATAATAAATTTGG + Intergenic
952035682 3:29197642-29197664 CCACCCTAAGAGTATAAACTGGG - Intergenic
952180598 3:30912673-30912695 TCATCCTAAAATATTAAAATGGG - Intergenic
953349554 3:42204950-42204972 CCATCTTATCATATTAAACATGG - Intronic
953761176 3:45688562-45688584 CCATCCCATCCTAGTAAACTGGG + Intergenic
959081540 3:101806897-101806919 CCAACACAAAATAATAAACTGGG - Intronic
960288872 3:115860284-115860306 CCTTACTAACATTATAAGCTTGG - Intronic
960801683 3:121546227-121546249 CCATGCTAACTTCATAAAATGGG + Intronic
960934907 3:122892891-122892913 CCATCATAAAATAATACACAGGG + Intergenic
962023477 3:131524744-131524766 GCATGCTAATCTAATAAACTGGG + Intergenic
963703181 3:148652411-148652433 CCATCCTGACATTCTAAACCAGG + Intergenic
964990031 3:162799403-162799425 CCATCCTGACATAACTAACTAGG + Intergenic
966552394 3:181219636-181219658 TTATCCTCACATAATAAAATGGG + Intergenic
967009846 3:185422571-185422593 CCATCCTAACATTATGTATTGGG + Intronic
970267793 4:14308313-14308335 CCAACCTGACATATTAAACTTGG - Intergenic
972679768 4:41294147-41294169 CCATCCAGACCTATTAAACTTGG + Intergenic
974940219 4:68458961-68458983 CCCTCCTAACCTAATGAGCTAGG - Intronic
975602427 4:76116328-76116350 CCATTCTAACATAATAAAATTGG + Intronic
976399574 4:84592506-84592528 AAATACTTACATAATAAACTTGG - Intronic
977442728 4:97090021-97090043 CCATGCTGACATCATATACTGGG - Intergenic
980418175 4:132520699-132520721 CCATCAAAACATCATAAACTGGG - Intergenic
982777796 4:159459687-159459709 CCAACCTAATATTATAAAGTAGG - Intergenic
984541619 4:181044611-181044633 CCATATTAACAGAATAAATTAGG - Intergenic
985114815 4:186580273-186580295 CCATCATACCTTAATAAAGTTGG - Intergenic
986821938 5:11476966-11476988 CCACTTTAACATAAAAAACTGGG + Intronic
989157111 5:38354742-38354764 CCATAAAAACATAAAAAACTGGG - Intronic
990767686 5:59205024-59205046 CCATTCTAACATAAGGAACTAGG + Intronic
992553052 5:77877340-77877362 CCATCCAAACAAAGTCAACTTGG + Intergenic
995406845 5:111807448-111807470 CCATCATAACATGATGAAATTGG - Intronic
997804524 5:136903263-136903285 CCTTCTTAAAATAATAAACAAGG - Intergenic
997845356 5:137281200-137281222 TCACCCTAACATTATAATCTGGG + Intronic
998243577 5:140474089-140474111 CCATCCAAATTGAATAAACTTGG + Intronic
998674654 5:144393780-144393802 CTCTCCTAACAAAATAAAGTTGG - Intronic
999124279 5:149235464-149235486 GCATCCTAACATAATTAGCCAGG - Intronic
999493195 5:152071607-152071629 CTATCCTAACAGTATAAACAGGG + Intergenic
1003355729 6:5368260-5368282 ACATGATAACATAATAAACGAGG + Intronic
1005246638 6:23893230-23893252 CCATCCCAACATAAGAATCTAGG - Intergenic
1006036212 6:31214777-31214799 ACATGATAACATAACAAACTAGG + Intergenic
1008843564 6:55934811-55934833 CCTTCCTAGCATCAGAAACTTGG - Intergenic
1009955867 6:70452393-70452415 CCATATTAAAATAATAAAGTTGG - Intronic
1014634733 6:123831219-123831241 CTATCCTGAAATAATATACTTGG + Intronic
1015318004 6:131839075-131839097 CCATGCTAACTTCATAAACTAGG - Intronic
1016824294 6:148374049-148374071 CCATCCTGACAGAATCAACTAGG + Intronic
1016970319 6:149756113-149756135 CCCTCCTCACAGAATAAACGTGG - Intronic
1020425549 7:8062104-8062126 CTATACTAAAATAAAAAACTTGG + Intronic
1021062319 7:16129371-16129393 CCATCCAAACACAAAAAATTGGG - Intronic
1021927489 7:25547405-25547427 CCATCTTGACAGAATAAAATGGG + Intergenic
1023063353 7:36351057-36351079 ACTTCCTAACATAATGAAGTTGG + Intronic
1024637482 7:51302154-51302176 CCCTCCCAGCATAATAAATTTGG + Intronic
1027774533 7:82447392-82447414 CTATCCTAAACTAATAAACAAGG + Intergenic
1028859528 7:95633128-95633150 CCACCATAACATAATAAATTAGG + Intergenic
1030506393 7:110429154-110429176 CCATATTAACAAAATAAAATGGG + Intergenic
1034861106 7:154595464-154595486 CCATCCTAGGATTATAAACTGGG + Intronic
1038133729 8:24763011-24763033 CCCTCCTGACATAAACAACTAGG - Intergenic
1038480602 8:27899226-27899248 CCATTCTGACATAATCAACCTGG - Intronic
1039075369 8:33686048-33686070 CCATCTTCACAAAAGAAACTTGG - Intergenic
1039141256 8:34391121-34391143 ACATCCTAACATAATCAGTTTGG + Intergenic
1039286745 8:36049941-36049963 CCAAGCTAACATAATGAATTAGG - Intergenic
1039976676 8:42372347-42372369 CCATCTCAAAAAAATAAACTAGG + Intergenic
1041045667 8:53883561-53883583 CCAACCTAACTGCATAAACTTGG + Intronic
1041125599 8:54635402-54635424 CCATCCTATCTTAATTTACTTGG - Intergenic
1042331133 8:67581854-67581876 CGATCCTTCCCTAATAAACTAGG - Intronic
1043530245 8:81142110-81142132 CCATCCTCCAATAATAAACATGG - Intergenic
1044001443 8:86886418-86886440 AAATCATATCATAATAAACTTGG - Intronic
1044436629 8:92171796-92171818 CCATGGTAGCATGATAAACTGGG + Intergenic
1048057708 8:130884183-130884205 CCATTTTAACATAATAAATGAGG - Intronic
1050498537 9:6269537-6269559 CCATGATAACAAAATTAACTGGG + Intergenic
1050742328 9:8836485-8836507 CCATCCTAACAAAAAATAGTGGG + Intronic
1050782863 9:9360805-9360827 ACTTCCTCACATAATACACTTGG - Intronic
1052084786 9:24251238-24251260 CCATCCTTGCATGATAAACATGG + Intergenic
1055434405 9:76277880-76277902 CCACCCGAAGATAATGAACTGGG - Intronic
1058038167 9:100275654-100275676 CCATCCTAACATAATAAACTGGG - Intronic
1058162185 9:101581605-101581627 CCTTACTAAGACAATAAACTTGG + Intronic
1190029071 X:46954281-46954303 CCATACTAACCTCATTAACTTGG + Intronic
1192818903 X:74622458-74622480 CGATACTAACATAATTAACCAGG - Intergenic
1193623903 X:83793499-83793521 CCTTCCTAACATTTTTAACTGGG - Intergenic
1194529594 X:95029012-95029034 CTATCCAACCATAATAAAGTAGG + Intergenic
1196513157 X:116538142-116538164 CTATCCTTACATAATAAGTTAGG + Intergenic
1196847607 X:119909009-119909031 ACAGTCTAACACAATAAACTGGG - Intronic
1200229330 X:154436484-154436506 CCTTCCTAATAAAATAAACGCGG + Exonic
1202277507 Y:23139327-23139349 CTATCCTTAAAGAATAAACTAGG + Intronic
1202288521 Y:23281361-23281383 CTATCCTTAAAGAATAAACTAGG - Intronic
1202430499 Y:24773050-24773072 CTATCCTTAAAGAATAAACTAGG + Intronic
1202440293 Y:24897037-24897059 CTATCCTTAAAGAATAAACTAGG - Intronic