ID: 1058041072

View in Genome Browser
Species Human (GRCh38)
Location 9:100302635-100302657
Sequence AGTTATTCTCAGTTGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058041072_1058041079 26 Left 1058041072 9:100302635-100302657 CCCAGTGCCAACTGAGAATAACT No data
Right 1058041079 9:100302684-100302706 CAATCTCTTCTTTACAAAGATGG No data
1058041072_1058041080 27 Left 1058041072 9:100302635-100302657 CCCAGTGCCAACTGAGAATAACT No data
Right 1058041080 9:100302685-100302707 AATCTCTTCTTTACAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058041072 Original CRISPR AGTTATTCTCAGTTGGCACT GGG (reversed) Intronic