ID: 1058041073

View in Genome Browser
Species Human (GRCh38)
Location 9:100302636-100302658
Sequence GAGTTATTCTCAGTTGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058041073_1058041079 25 Left 1058041073 9:100302636-100302658 CCAGTGCCAACTGAGAATAACTC No data
Right 1058041079 9:100302684-100302706 CAATCTCTTCTTTACAAAGATGG No data
1058041073_1058041080 26 Left 1058041073 9:100302636-100302658 CCAGTGCCAACTGAGAATAACTC No data
Right 1058041080 9:100302685-100302707 AATCTCTTCTTTACAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058041073 Original CRISPR GAGTTATTCTCAGTTGGCAC TGG (reversed) Intronic