ID: 1058041073 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:100302636-100302658 |
Sequence | GAGTTATTCTCAGTTGGCAC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1058041073_1058041079 | 25 | Left | 1058041073 | 9:100302636-100302658 | CCAGTGCCAACTGAGAATAACTC | No data | ||
Right | 1058041079 | 9:100302684-100302706 | CAATCTCTTCTTTACAAAGATGG | No data | ||||
1058041073_1058041080 | 26 | Left | 1058041073 | 9:100302636-100302658 | CCAGTGCCAACTGAGAATAACTC | No data | ||
Right | 1058041080 | 9:100302685-100302707 | AATCTCTTCTTTACAAAGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1058041073 | Original CRISPR | GAGTTATTCTCAGTTGGCAC TGG (reversed) | Intronic | ||