ID: 1058041078

View in Genome Browser
Species Human (GRCh38)
Location 9:100302670-100302692
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058041078_1058041082 10 Left 1058041078 9:100302670-100302692 CCAACAATTTCTGTCAATCTCTT No data
Right 1058041082 9:100302703-100302725 ATGGGCTGATTCCCCAGTCTGGG No data
1058041078_1058041081 9 Left 1058041078 9:100302670-100302692 CCAACAATTTCTGTCAATCTCTT No data
Right 1058041081 9:100302702-100302724 GATGGGCTGATTCCCCAGTCTGG No data
1058041078_1058041079 -9 Left 1058041078 9:100302670-100302692 CCAACAATTTCTGTCAATCTCTT No data
Right 1058041079 9:100302684-100302706 CAATCTCTTCTTTACAAAGATGG No data
1058041078_1058041080 -8 Left 1058041078 9:100302670-100302692 CCAACAATTTCTGTCAATCTCTT No data
Right 1058041080 9:100302685-100302707 AATCTCTTCTTTACAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058041078 Original CRISPR AAGAGATTGACAGAAATTGT TGG (reversed) Intronic