ID: 1058041079

View in Genome Browser
Species Human (GRCh38)
Location 9:100302684-100302706
Sequence CAATCTCTTCTTTACAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058041077_1058041079 -5 Left 1058041077 9:100302666-100302688 CCAACCAACAATTTCTGTCAATC No data
Right 1058041079 9:100302684-100302706 CAATCTCTTCTTTACAAAGATGG No data
1058041073_1058041079 25 Left 1058041073 9:100302636-100302658 CCAGTGCCAACTGAGAATAACTC No data
Right 1058041079 9:100302684-100302706 CAATCTCTTCTTTACAAAGATGG No data
1058041074_1058041079 19 Left 1058041074 9:100302642-100302664 CCAACTGAGAATAACTCTACAGG No data
Right 1058041079 9:100302684-100302706 CAATCTCTTCTTTACAAAGATGG No data
1058041071_1058041079 27 Left 1058041071 9:100302634-100302656 CCCCAGTGCCAACTGAGAATAAC No data
Right 1058041079 9:100302684-100302706 CAATCTCTTCTTTACAAAGATGG No data
1058041072_1058041079 26 Left 1058041072 9:100302635-100302657 CCCAGTGCCAACTGAGAATAACT No data
Right 1058041079 9:100302684-100302706 CAATCTCTTCTTTACAAAGATGG No data
1058041078_1058041079 -9 Left 1058041078 9:100302670-100302692 CCAACAATTTCTGTCAATCTCTT No data
Right 1058041079 9:100302684-100302706 CAATCTCTTCTTTACAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058041079 Original CRISPR CAATCTCTTCTTTACAAAGA TGG Intronic