ID: 1058041081

View in Genome Browser
Species Human (GRCh38)
Location 9:100302702-100302724
Sequence GATGGGCTGATTCCCCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058041077_1058041081 13 Left 1058041077 9:100302666-100302688 CCAACCAACAATTTCTGTCAATC No data
Right 1058041081 9:100302702-100302724 GATGGGCTGATTCCCCAGTCTGG No data
1058041078_1058041081 9 Left 1058041078 9:100302670-100302692 CCAACAATTTCTGTCAATCTCTT No data
Right 1058041081 9:100302702-100302724 GATGGGCTGATTCCCCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058041081 Original CRISPR GATGGGCTGATTCCCCAGTC TGG Intronic