ID: 1058041521

View in Genome Browser
Species Human (GRCh38)
Location 9:100307344-100307366
Sequence ATGGCTACTCAGCACTACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058041521_1058041522 -7 Left 1058041521 9:100307344-100307366 CCGTGGTAGTGCTGAGTAGCCAT 0: 1
1: 1
2: 0
3: 6
4: 112
Right 1058041522 9:100307360-100307382 TAGCCATGACAGAGACCTAATGG 0: 1
1: 0
2: 3
3: 26
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058041521 Original CRISPR ATGGCTACTCAGCACTACCA CGG (reversed) Intronic
904774153 1:32896454-32896476 TTGGCTTCTCAGCCCTACCTGGG + Intronic
907676666 1:56524006-56524028 ATGGGTCCAAAGCACTACCAAGG - Intronic
915399419 1:155611544-155611566 ATCACTACTCAGCACTCCCTGGG - Exonic
915416532 1:155747124-155747146 ATCACTACTCAGCACTCCCTGGG - Intergenic
920710839 1:208293511-208293533 ATAGCTTCACAGCCCTACCAGGG - Intergenic
1063246398 10:4224176-4224198 AAAGCTACTCAGAACAACCACGG - Intergenic
1070987576 10:80701478-80701500 AGGGCTACTCTTCACTGCCAGGG - Intergenic
1072176149 10:92923865-92923887 ACTGATACTCAGTACTACCATGG + Intronic
1077131499 11:975192-975214 ACGGCTACTCTGCACCTCCACGG - Intronic
1079427940 11:20361745-20361767 AAGGCTACTCAGCAATAAAAAGG + Intergenic
1081256863 11:40907238-40907260 AAAGTTACTCAGCACTACAAGGG - Intronic
1083115322 11:60453715-60453737 ATTCCTTCTCAGCACTGCCAGGG + Intronic
1084267347 11:68011842-68011864 ATGGATACTGAGCACTTCCCGGG + Intronic
1085756411 11:79205652-79205674 AATGCTACTCAGCACTAACAAGG - Intronic
1085772065 11:79334506-79334528 ATGGCTGCCCAGCACTGTCAGGG + Intronic
1089006521 11:115096082-115096104 AGTGCTCCTCAGCACTGCCAAGG + Intergenic
1089765106 11:120757499-120757521 ATGGCTACTGAGCCCTCCCTGGG - Intronic
1090738384 11:129632908-129632930 ATGGCTAAGCATCACCACCAGGG + Intergenic
1094022973 12:25933892-25933914 ATGGCTACACCTCACTACAAGGG + Intergenic
1094136547 12:27133110-27133132 GAGGCTAGTCTGCACTACCAGGG + Intergenic
1094629717 12:32161205-32161227 ATTACTACTCAGCACTATGATGG - Intronic
1097674342 12:62582341-62582363 ATGTCTTCTCAGCACTAACTTGG + Intronic
1103207215 12:119139301-119139323 ATGTCTCCTCTGCACTTCCACGG + Intronic
1103414317 12:120733696-120733718 ATGGGAACTCAGAGCTACCAGGG - Intronic
1103474563 12:121209382-121209404 ATGGCTACTCCGCACAGCCCCGG + Intergenic
1111783949 13:92764095-92764117 ATGGCTACTCAGCTCAGCCAAGG + Intronic
1118528236 14:66670188-66670210 ATGCCTACACAGCAGTAACATGG - Intronic
1121403470 14:93703225-93703247 CTGGCTTCCCAGGACTACCAAGG + Intronic
1121576923 14:94996147-94996169 ATGGCTACCCAGCATCACCCAGG + Intergenic
1121937110 14:98030004-98030026 ACAGCTACTCACCTCTACCATGG + Intergenic
1122091647 14:99344803-99344825 ACAGCTACTCAGCTCTGCCATGG + Intergenic
1122648376 14:103210061-103210083 CTGTCTGCTCAGCACCACCAAGG + Intergenic
1122650921 14:103226692-103226714 ACGGCCACTCAGCCCTACCTGGG + Intergenic
1123582731 15:21731017-21731039 AGGGGTACTCAGAACTGCCAGGG - Intergenic
1123619381 15:22173613-22173635 AGGGGTACTCAGAACTGCCAGGG - Intergenic
1125551540 15:40548706-40548728 ATGCCGGCTCAGAACTACCAAGG + Intronic
1132143805 15:99415106-99415128 GTGGCTACTCTGTTCTACCAAGG - Intergenic
1138634787 16:58329479-58329501 AAGGATATTCAGCACAACCATGG - Intronic
1139712681 16:68788593-68788615 ATAGCTACTCAGCAATAAAAAGG - Intronic
1142516952 17:438211-438233 TTGGCTAATCAGCAGTTCCAAGG - Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1148609971 17:48958549-48958571 ATGACTACTGAGCACTAACAGGG - Exonic
1152095675 17:78270300-78270322 ATGGCTGCTCAGCGGGACCAGGG + Intergenic
1156273384 18:35558038-35558060 GATGCTACTCAGCAATACCAAGG - Intergenic
1158943563 18:62428513-62428535 ATGGCATCTCAGCAGTAACAAGG - Intergenic
1165960835 19:39532950-39532972 ATGGCTACTCAGGACCGCTAGGG - Intergenic
1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG + Exonic
927284795 2:21345438-21345460 ATTGCTTTTCACCACTACCAAGG + Intergenic
928687044 2:33760498-33760520 ATGGCTACACCGAACTACAAAGG + Intergenic
929343538 2:40852850-40852872 ATGTCTACTCTGGACTAACAGGG + Intergenic
929582325 2:43089641-43089663 ATGGCCACTCAGCAATCCAAAGG + Intergenic
929712598 2:44279970-44279992 GTGGCTACTGAGCACTTGCAGGG - Intronic
934680682 2:96281826-96281848 ATGGATACCCAGTACTACAATGG - Exonic
938528995 2:132163740-132163762 ATGGATGCTCAGCACCACCCCGG + Intronic
939006442 2:136792925-136792947 AATACTACTCAGCAATACCAAGG - Intronic
941714494 2:168749436-168749458 CTGTCTTCTCAGCACTTCCAGGG + Intronic
946277987 2:218644903-218644925 ATGGCTTCCCAGCACCACCCTGG - Exonic
946584403 2:221168464-221168486 TTGGCTAATAAGCACTACCCTGG + Intergenic
948814353 2:240502304-240502326 CTGGCTACTCAGCAGCACCTGGG + Intronic
1171006496 20:21470874-21470896 ATAGCTAATTAGCCCTACCAAGG - Intergenic
1173378937 20:42519304-42519326 ATTACTACTCAGCAATACAAAGG - Intronic
1174932823 20:54833923-54833945 CCGGCTACTCAGCACTTCAAGGG + Intergenic
1182134128 22:27884563-27884585 ATGGCTTTTCAGCATCACCAAGG - Intronic
1183068021 22:35377039-35377061 ATCGCGACTCAGCATTCCCAAGG - Intergenic
1184590118 22:45476429-45476451 GTGTCTCCTCAGCACCACCAGGG - Intergenic
950788199 3:15452889-15452911 ATGGCTCCCCAGCCCTGCCAAGG + Intronic
953544581 3:43855079-43855101 ATGGAGAGCCAGCACTACCATGG + Intergenic
954901272 3:54022101-54022123 AAAGATACTCAGCACTTCCAGGG + Intergenic
956286993 3:67621111-67621133 ATGGCTAGTTTGCACTACAAAGG - Intronic
957901144 3:86493151-86493173 ATGTCTATTCAGCATTACAAAGG - Intergenic
959468771 3:106722576-106722598 ATGGCTACTTTGCCCTACAATGG - Intergenic
966831310 3:184011702-184011724 AATGCTACTCAGCAATACAAAGG + Intronic
969224383 4:5785297-5785319 ATGGCTTAACAGCACTGCCAGGG - Intronic
970212327 4:13722494-13722516 AAGGCTGCTCAGCTCTGCCAAGG + Intergenic
970714728 4:18908105-18908127 CAGGCTCCTCAGCACTATCAGGG - Intergenic
971245543 4:24924104-24924126 ATGGCTACACACCACTGCAAAGG + Intronic
976554944 4:86439431-86439453 AAGGCTACTCAGCAATAAAAAGG - Intronic
982688714 4:158524263-158524285 ATGGCTACTGAGAATTATCATGG - Intronic
982721373 4:158863472-158863494 ATGGCTGCTCAGCACTACCAGGG + Intronic
985820781 5:2158770-2158792 ATGGCAACTCAGCCCCACAAAGG + Intergenic
989339016 5:40353935-40353957 CTGGCTTCTCAGCGCTTCCACGG + Intergenic
990317181 5:54594075-54594097 AACCCTACTCAGCATTACCAAGG + Intergenic
990976449 5:61565517-61565539 TTGGATACTCACCACTACCTGGG + Intergenic
993151579 5:84169726-84169748 ATTGCTACTCAGCAATGCAAAGG - Intronic
993977122 5:94496316-94496338 ATGGCTACTCTGCGCTACAATGG + Intronic
996445034 5:123538018-123538040 ATGACTACTCAGCATTAAAAAGG - Intronic
1005798820 6:29397281-29397303 GTGGCTACTCAGTACTGTCACGG + Exonic
1009767082 6:68092113-68092135 ATGGCTACTCAACAGAATCAAGG + Intergenic
1010925879 6:81745370-81745392 AAGGCTACTCAGGAAGACCAAGG + Intronic
1012336799 6:98069817-98069839 TTTGTTACTCAGCACTACTATGG + Intergenic
1014509354 6:122301992-122302014 ATCTCTACTCATCACTTCCAGGG + Intergenic
1020677525 7:11198756-11198778 ATGGCTACCCCTCACTACAAAGG - Intergenic
1021249120 7:18302788-18302810 ATGACTACTGAGCACTCCCTAGG - Intronic
1022820680 7:33957258-33957280 ATGGATACTCAGCAATAAAAAGG + Intronic
1027443601 7:78246389-78246411 ATGGCTGCTCAGCTTCACCAGGG - Intronic
1032386042 7:131524890-131524912 ATGACTACTCAGCAATAAAAAGG + Intronic
1035253430 7:157611939-157611961 CTCGCTCCTCAGCACGACCACGG - Intronic
1037626254 8:20609641-20609663 ATGGCTACTCATGTCCACCAAGG + Intergenic
1038609320 8:29045150-29045172 ATGGCTACTGAGCACTTGAAAGG - Intronic
1040696403 8:50004806-50004828 ATGGCTACTTAGAACTAAAAGGG + Intronic
1040778987 8:51083633-51083655 ATGGCTACTAGGCAATAGCAAGG + Intergenic
1041506886 8:58608882-58608904 ATGGCCCCACAGCACTACCAGGG + Intronic
1050582275 9:7072427-7072449 AATGCTACTCAGCACTAAAAAGG + Intronic
1050795220 9:9531218-9531240 AATGCTACTCAGCACTAAAAAGG + Intronic
1050899971 9:10934753-10934775 AAGGCTACTTAACACTTCCAAGG + Intergenic
1053091117 9:35277840-35277862 ATGGGTACACAGTAATACCATGG + Intronic
1053091123 9:35277875-35277897 ATGGGTACACAGTAATACCATGG + Intronic
1053707594 9:40770053-40770075 ATGGATGCTCAGCACCACCCCGG + Intergenic
1054417507 9:64890839-64890861 ATGGATGCTCAGCACCACCCCGG + Intergenic
1055031921 9:71779023-71779045 ATGACAACTCAGGACTTCCAAGG - Intronic
1058041521 9:100307344-100307366 ATGGCTACTCAGCACTACCACGG - Intronic
1060175954 9:121497896-121497918 ATGGCTGCTCAGAGCCACCATGG + Intergenic
1186308325 X:8289540-8289562 GTGGCTACTCACCACTAACAAGG + Intergenic
1186500943 X:10050082-10050104 ATGGCTGCAAAGCACTAACAGGG - Intronic
1189923681 X:45930597-45930619 ATGGCTCCTAAGCACTCCAAGGG + Intergenic
1190574884 X:51825264-51825286 ATGGCTACTCAGCAGCACAGTGG + Intronic
1192305379 X:69953692-69953714 ACTGCTACTCAGCACTAAAAAGG + Intronic
1192971312 X:76234003-76234025 AGGCCTACTTAGCACTGCCAGGG - Intergenic
1199883644 X:151997133-151997155 AATACTACTCAGCACTACAAAGG - Intergenic
1200756269 Y:6992733-6992755 CAGGCTAGTCACCACTACCAAGG - Intronic