ID: 1058045516

View in Genome Browser
Species Human (GRCh38)
Location 9:100352986-100353008
Sequence GCCGCGCGCAACCGGGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058045502_1058045516 18 Left 1058045502 9:100352945-100352967 CCCTCCCCCTCCCTGCTGTGCTC 0: 1
1: 0
2: 15
3: 123
4: 1100
Right 1058045516 9:100352986-100353008 GCCGCGCGCAACCGGGGAGGCGG 0: 1
1: 0
2: 1
3: 9
4: 125
1058045501_1058045516 19 Left 1058045501 9:100352944-100352966 CCCCTCCCCCTCCCTGCTGTGCT 0: 1
1: 0
2: 16
3: 128
4: 1201
Right 1058045516 9:100352986-100353008 GCCGCGCGCAACCGGGGAGGCGG 0: 1
1: 0
2: 1
3: 9
4: 125
1058045503_1058045516 17 Left 1058045503 9:100352946-100352968 CCTCCCCCTCCCTGCTGTGCTCA 0: 1
1: 0
2: 6
3: 115
4: 845
Right 1058045516 9:100352986-100353008 GCCGCGCGCAACCGGGGAGGCGG 0: 1
1: 0
2: 1
3: 9
4: 125
1058045504_1058045516 14 Left 1058045504 9:100352949-100352971 CCCCCTCCCTGCTGTGCTCACGT 0: 1
1: 0
2: 2
3: 32
4: 349
Right 1058045516 9:100352986-100353008 GCCGCGCGCAACCGGGGAGGCGG 0: 1
1: 0
2: 1
3: 9
4: 125
1058045505_1058045516 13 Left 1058045505 9:100352950-100352972 CCCCTCCCTGCTGTGCTCACGTG 0: 1
1: 0
2: 1
3: 79
4: 2282
Right 1058045516 9:100352986-100353008 GCCGCGCGCAACCGGGGAGGCGG 0: 1
1: 0
2: 1
3: 9
4: 125
1058045506_1058045516 12 Left 1058045506 9:100352951-100352973 CCCTCCCTGCTGTGCTCACGTGA 0: 1
1: 0
2: 0
3: 14
4: 286
Right 1058045516 9:100352986-100353008 GCCGCGCGCAACCGGGGAGGCGG 0: 1
1: 0
2: 1
3: 9
4: 125
1058045507_1058045516 11 Left 1058045507 9:100352952-100352974 CCTCCCTGCTGTGCTCACGTGAT 0: 1
1: 0
2: 3
3: 31
4: 400
Right 1058045516 9:100352986-100353008 GCCGCGCGCAACCGGGGAGGCGG 0: 1
1: 0
2: 1
3: 9
4: 125
1058045508_1058045516 8 Left 1058045508 9:100352955-100352977 CCCTGCTGTGCTCACGTGATCGC 0: 1
1: 0
2: 0
3: 4
4: 167
Right 1058045516 9:100352986-100353008 GCCGCGCGCAACCGGGGAGGCGG 0: 1
1: 0
2: 1
3: 9
4: 125
1058045509_1058045516 7 Left 1058045509 9:100352956-100352978 CCTGCTGTGCTCACGTGATCGCA 0: 1
1: 0
2: 0
3: 2
4: 105
Right 1058045516 9:100352986-100353008 GCCGCGCGCAACCGGGGAGGCGG 0: 1
1: 0
2: 1
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058045516 Original CRISPR GCCGCGCGCAACCGGGGAGG CGG Intergenic
900233405 1:1574403-1574425 GCCAGGGGGAACCGGGGAGGAGG + Intronic
900524464 1:3121736-3121758 GCAGCGCGCAGCCGAGGTGGAGG - Intronic
902304686 1:15526977-15526999 GACGCGCGGAACCGCGGACGCGG + Intronic
902412254 1:16218298-16218320 GCCTGGCACAACAGGGGAGGTGG - Intergenic
903879653 1:26500378-26500400 TCCGCGCCCCACCTGGGAGGCGG + Intergenic
903925202 1:26826854-26826876 ACGGCGCGCCCCCGGGGAGGCGG - Exonic
904744673 1:32703220-32703242 GCAGGGCGCGGCCGGGGAGGAGG + Intronic
909585235 1:77281933-77281955 GGCGCGCTGAACCGGAGAGGCGG + Intergenic
912363475 1:109113874-109113896 GCCGCGCGCACCAGCGGCGGCGG + Intronic
918282841 1:183023188-183023210 GCGGCGCGCGACCCGGGGGGAGG - Intergenic
921325295 1:213982693-213982715 GACGCGCTCGACCTGGGAGGGGG - Intergenic
922440677 1:225653130-225653152 GCCGCGAGGAACCCGGGAGGAGG + Exonic
923056126 1:230426570-230426592 GCCACGCGCAGCGCGGGAGGGGG + Intergenic
1075129547 10:119726236-119726258 GCCCCGCGCGCCCAGGGAGGCGG - Exonic
1075334568 10:121598717-121598739 GCCTCGCTCGCCCGGGGAGGAGG - Intergenic
1075800683 10:125151845-125151867 GCCGCTCGGACCCGGGGCGGCGG - Intronic
1079430977 11:20387914-20387936 GCCGCGGGCGAACGGGGCGGAGG + Intronic
1084023197 11:66430665-66430687 GCCGAGCGGAACTGAGGAGGGGG + Intergenic
1084153824 11:67303283-67303305 GCCGGGCGCTTCCTGGGAGGGGG + Intergenic
1089596532 11:119584449-119584471 GCCGCGCGGAGCCGCGGAAGAGG - Intergenic
1089622284 11:119728890-119728912 GCGCCGCGCAACCGGGCAGCCGG - Exonic
1091273115 11:134331876-134331898 GCCTCGCGCAAGCGGGGGCGGGG - Exonic
1096700624 12:53380493-53380515 GCCGCCCGCCCCGGGGGAGGGGG + Intronic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1101763666 12:107679730-107679752 GCCTCGTGCAATGGGGGAGGAGG + Intergenic
1104982827 12:132581845-132581867 GGCGCGGGCATCGGGGGAGGGGG - Intronic
1105004207 12:132710966-132710988 GCCGCGCGCAGGCGGGGACGCGG + Exonic
1110407111 13:75162913-75162935 GCAGCGGGCTACCGGAGAGGGGG + Intergenic
1112091692 13:96090456-96090478 GCCGCGCGCAGCCGGGCAGCCGG - Intergenic
1112173133 13:96994271-96994293 GCCGCGCGTGATCGGGGAGCGGG - Intronic
1113378996 13:109786298-109786320 GCCGCAGGCAGCCGGGGAGGGGG - Exonic
1113820370 13:113209024-113209046 GGCGCGCGCGCCCGAGGAGGGGG + Intronic
1120788121 14:88555024-88555046 GGCGGGCGGATCCGGGGAGGCGG + Intergenic
1122220842 14:100238572-100238594 GCCGCGCGACACCGGGAAGCGGG + Intronic
1122882136 14:104694968-104694990 GCCTCTCTCAACCTGGGAGGGGG - Intronic
1122951544 14:105047772-105047794 GACGGGCGCAGCTGGGGAGGTGG - Intergenic
1123115539 14:105892588-105892610 GCCGTGCACCACCGGGCAGGAGG - Intergenic
1124629383 15:31328025-31328047 CCCGAGCGCGCCCGGGGAGGGGG - Intronic
1129356621 15:74996041-74996063 GGCGTGCGCAGCCGGGGATGGGG + Intronic
1132481105 16:166501-166523 GCAGCGCGCAGCCGGGGTGGGGG + Intronic
1132889504 16:2196803-2196825 GCTGCGCGCACGTGGGGAGGGGG - Intergenic
1133029608 16:3004207-3004229 GGCGGCCGCAACCGGGGTGGCGG + Intergenic
1137531977 16:49283547-49283569 GCCGTGCTCAACGGGGGCGGGGG - Intergenic
1140223117 16:73058203-73058225 GCGGCGCGGGGCCGGGGAGGAGG + Intronic
1141054559 16:80803839-80803861 GCCGGGCGGAGCCGGGGCGGGGG - Intronic
1141527158 16:84618633-84618655 GCCGGGGGCAGCAGGGGAGGGGG - Intergenic
1142206470 16:88785320-88785342 GCCGCGCGGGACAGCGGAGGGGG - Intergenic
1142683301 17:1562504-1562526 GCCGTGCGGAAGCGGGGAGGAGG - Intronic
1146058714 17:29593576-29593598 GCGGCGCCCGGCCGGGGAGGAGG - Exonic
1146183201 17:30709869-30709891 GGCGCGCGGAAGAGGGGAGGCGG + Intergenic
1147743774 17:42683071-42683093 GCCGCGCGCGCCCGGGGCTGGGG + Intronic
1148090909 17:45022056-45022078 GCCGCCCGCGGCCTGGGAGGAGG + Intergenic
1148564472 17:48625103-48625125 GGCCGGCGCATCCGGGGAGGGGG + Intronic
1148616500 17:49004297-49004319 GCAGCCCGCAGCCGGTGAGGGGG - Intronic
1148796838 17:50201140-50201162 CGAGCGCGCAACCGGGGAAGTGG - Intronic
1150124471 17:62627592-62627614 GGAGCGCAGAACCGGGGAGGAGG - Exonic
1151964360 17:77423632-77423654 TCCGCGCGGAGCCGGGGAAGGGG - Intronic
1152938307 17:83153059-83153081 GCCGCGCGCATCCTCGGGGGGGG + Intergenic
1157496747 18:48161933-48161955 GCCGCGGCCTCCCGGGGAGGCGG - Intronic
1157515078 18:48305064-48305086 GCCCCGCGCACCTGGGGAGCAGG - Intronic
1159947775 18:74457014-74457036 GCGCCGCGCGTCCGGGGAGGGGG - Intronic
1160972438 19:1775570-1775592 GCCCCCCACACCCGGGGAGGGGG + Exonic
1161238138 19:3208032-3208054 GCCGCGCGCGATCGGGCAGGGGG - Exonic
1162030763 19:7916403-7916425 GCCGCGGGGAACGGGGGAGCTGG - Exonic
1162031697 19:7920373-7920395 GCCGCTCGCCGCCTGGGAGGTGG - Exonic
1162537610 19:11272671-11272693 GCCACACGCAACCTGGGTGGAGG - Intergenic
1162938947 19:13996611-13996633 GCCTCGAGCAACTGGTGAGGGGG + Intronic
1163158101 19:15449786-15449808 GCCGGGCCTCACCGGGGAGGCGG + Exonic
1163583697 19:18153165-18153187 GCCGCTCGGAACCGTGGCGGCGG + Exonic
1164639298 19:29812456-29812478 CCCGCGCGCAAAGGGGGAAGGGG + Intronic
1165591554 19:36973518-36973540 GCCGCGCGCAGGCAGGGAGTGGG + Intronic
1166126533 19:40718172-40718194 GCCCCCCTCAACCCGGGAGGGGG - Exonic
1167049001 19:47067489-47067511 GCCGCCCCCAACGGAGGAGGAGG - Exonic
1167094056 19:47364255-47364277 GCCACGCCCAACCGTGAAGGAGG + Intronic
1168280230 19:55301815-55301837 GCCGCTCCAAACTGGGGAGGGGG + Intronic
925601149 2:5609880-5609902 GCCATGCTCAACTGGGGAGGGGG + Intergenic
934782174 2:96977683-96977705 GCTGCACGCAATGGGGGAGGGGG + Intronic
937208531 2:120252692-120252714 GCAGCGGGCGGCCGGGGAGGAGG - Intronic
944811108 2:203328357-203328379 CCAGCGCGCGACAGGGGAGGGGG - Exonic
1169758787 20:9068915-9068937 GCGGCGCGGAGACGGGGAGGCGG + Intronic
1172100698 20:32483003-32483025 GCGGCGCGCACCCCGGGAGTGGG + Intronic
1173221575 20:41136869-41136891 GCCCCGCGCTGCCGGGGGGGCGG + Intergenic
1175964297 20:62652751-62652773 GCCGCGGGCACCCAGGGAGCAGG + Intronic
1175997297 20:62817484-62817506 GCCGCTCGGGACCCGGGAGGAGG + Intronic
1176549989 21:8216961-8216983 GCGGCGCTCCCCCGGGGAGGGGG - Intergenic
1176568915 21:8399995-8400017 GCGGCGCTCCCCCGGGGAGGGGG - Intergenic
1176576829 21:8444230-8444252 GCGGCGCTCCCCCGGGGAGGGGG - Intergenic
1178350876 21:31872759-31872781 GCCGCACCCACCCGGGGCGGGGG - Intergenic
1180202061 21:46229813-46229835 GCCGGGCGCAACAGGGCAGGGGG + Intergenic
1180933220 22:19607432-19607454 GCTCCTCGCACCCGGGGAGGAGG + Intergenic
1181768887 22:25111633-25111655 GCCGAGGGCAGCCGGGCAGGGGG + Intronic
1182692853 22:32175962-32175984 GCCCTGCGCGCCCGGGGAGGGGG + Intergenic
1183664913 22:39241715-39241737 GGCGTGTGCAACCGCGGAGGGGG - Intronic
1184740500 22:46426132-46426154 GGAGGGCGCAGCCGGGGAGGGGG + Intronic
1203254879 22_KI270733v1_random:133287-133309 GCGGCGCTCCCCCGGGGAGGGGG - Intergenic
1203262935 22_KI270733v1_random:178366-178388 GCGGCGCTCCCCCGGGGAGGGGG - Intergenic
950829402 3:15859565-15859587 GCGGCGGGCGGCCGGGGAGGCGG - Exonic
951208238 3:19946908-19946930 GCCGCGCGTACCTGGGGTGGGGG + Intronic
959703127 3:109316621-109316643 GCCACACCCAACCGGGTAGGCGG - Intergenic
961260083 3:125595304-125595326 GGCGCGCGCAGCCGGGGAGGAGG + Intergenic
965404216 3:168249894-168249916 ACCGCGCGCAGCCCGGGCGGCGG + Intergenic
965586477 3:170323205-170323227 GCCACGCGAAGACGGGGAGGGGG + Intergenic
968506448 4:973363-973385 GCCGCGCGCGCCCGGGGCCGGGG - Exonic
969263207 4:6046596-6046618 GCAGGGTGCAAGCGGGGAGGTGG + Intronic
969682344 4:8650177-8650199 GGCCCGCGCATCCCGGGAGGTGG + Intergenic
971372305 4:26028901-26028923 GCCGGGCGCCACCCAGGAGGGGG + Intergenic
976226539 4:82798823-82798845 GGGGCGCGCGGCCGGGGAGGAGG + Exonic
979624105 4:122827029-122827051 GCCGCGCGCTGCCGGGCGGGAGG + Exonic
995241026 5:109885335-109885357 GCCGCGCGCAGCCGAGGCGCCGG - Intergenic
1001826691 5:174751200-174751222 GCCGCGAGCTCCCGGGGCGGAGG + Intergenic
1001948116 5:175797081-175797103 GCCGCGCGGAACCAGGGCGGAGG - Intronic
1007631718 6:43276518-43276540 GCCGCGCACGGGCGGGGAGGGGG + Intronic
1007702237 6:43771945-43771967 GCCGCGCGCACCCGGCCGGGCGG - Intronic
1012410228 6:98947985-98948007 GCGGGGCGGAGCCGGGGAGGAGG + Intronic
1014569902 6:122996355-122996377 TCCGGGAGCAGCCGGGGAGGTGG - Exonic
1019473242 7:1232277-1232299 GCCGCCTGCAGCCGGAGAGGAGG + Intergenic
1020101692 7:5397459-5397481 GCCCCGCCCAGCCTGGGAGGAGG - Intronic
1029413499 7:100429671-100429693 TGCGCGCGCAACCAGGGTGGTGG + Exonic
1032151775 7:129435039-129435061 GCCGCAGGCAGCCTGGGAGGGGG - Intronic
1032238085 7:130141523-130141545 GCCGGACGGAACTGGGGAGGGGG + Intergenic
1035432152 7:158829981-158830003 GCTGAGCGCAGCCGGGGTGGCGG + Intronic
1035761429 8:2071808-2071830 GCCGTCAGCAACCCGGGAGGAGG - Intronic
1038319212 8:26513019-26513041 GCAGTGCGCAACAGGGGCGGGGG + Intronic
1039983248 8:42427114-42427136 GCCAGGCGGAGCCGGGGAGGAGG + Intronic
1039996788 8:42541390-42541412 GGCGCGCGCAGCCCGGGCGGGGG + Intronic
1042267719 8:66925690-66925712 GCACCGCGCAACCAGGGAAGAGG - Intergenic
1045063499 8:98427069-98427091 GGCGCGCGGATCCGGAGAGGGGG + Exonic
1049509000 8:143018475-143018497 GCCGCGCGGCCCCGGGGCGGGGG - Intronic
1049584950 8:143428727-143428749 GTCGGGGGCAAGCGGGGAGGGGG + Exonic
1057869875 9:98709225-98709247 GCCGTGCGCGCCGGGGGAGGGGG + Intergenic
1058045516 9:100352986-100353008 GCCGCGCGCAACCGGGGAGGCGG + Intergenic
1060952267 9:127612018-127612040 GCCGCGCGCGCCCGGGGCGCAGG - Intergenic
1060973924 9:127754182-127754204 GGCGCGCGCAGGCCGGGAGGCGG - Intronic
1061084785 9:128392601-128392623 TCCGGGCGCAACAGGGGCGGGGG - Intergenic
1203471280 Un_GL000220v1:116432-116454 GCGGCGCTCCCCCGGGGAGGGGG - Intergenic
1203479101 Un_GL000220v1:160404-160426 GCGGCGCTCCCCCGGGGAGGGGG - Intergenic