ID: 1058045705

View in Genome Browser
Species Human (GRCh38)
Location 9:100354449-100354471
Sequence CCTTTCTAGGGCCTTCCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058045696_1058045705 20 Left 1058045696 9:100354406-100354428 CCCTTTAATGGCTCCCTATTTCA No data
Right 1058045705 9:100354449-100354471 CCTTTCTAGGGCCTTCCCTTAGG No data
1058045699_1058045705 6 Left 1058045699 9:100354420-100354442 CCTATTTCACTTCGAGTAAAACC No data
Right 1058045705 9:100354449-100354471 CCTTTCTAGGGCCTTCCCTTAGG No data
1058045698_1058045705 7 Left 1058045698 9:100354419-100354441 CCCTATTTCACTTCGAGTAAAAC No data
Right 1058045705 9:100354449-100354471 CCTTTCTAGGGCCTTCCCTTAGG No data
1058045697_1058045705 19 Left 1058045697 9:100354407-100354429 CCTTTAATGGCTCCCTATTTCAC No data
Right 1058045705 9:100354449-100354471 CCTTTCTAGGGCCTTCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058045705 Original CRISPR CCTTTCTAGGGCCTTCCCTT AGG Intergenic
No off target data available for this crispr