ID: 1058047265

View in Genome Browser
Species Human (GRCh38)
Location 9:100369934-100369956
Sequence ATGTCCATCCAAAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058047265_1058047267 8 Left 1058047265 9:100369934-100369956 CCTTCACTCTTTTGGATGGACAT No data
Right 1058047267 9:100369965-100369987 AGGTCTCTTTTTACATGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058047265 Original CRISPR ATGTCCATCCAAAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr