ID: 1058052259

View in Genome Browser
Species Human (GRCh38)
Location 9:100418826-100418848
Sequence AAGGAAACTGAATATGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058052257_1058052259 -6 Left 1058052257 9:100418809-100418831 CCAGTTTGACAGACGGGAAGGAA No data
Right 1058052259 9:100418826-100418848 AAGGAAACTGAATATGGACAAGG No data
1058052253_1058052259 15 Left 1058052253 9:100418788-100418810 CCTGAAGTCGCTGTAGGTCAGCC No data
Right 1058052259 9:100418826-100418848 AAGGAAACTGAATATGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058052259 Original CRISPR AAGGAAACTGAATATGGACA AGG Intergenic
No off target data available for this crispr