ID: 1058054316

View in Genome Browser
Species Human (GRCh38)
Location 9:100434225-100434247
Sequence CCTTTGAAACAGTCTTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058054309_1058054316 19 Left 1058054309 9:100434183-100434205 CCCTACCCTACTGTGGACACATA 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1058054316 9:100434225-100434247 CCTTTGAAACAGTCTTTGGCTGG No data
1058054313_1058054316 -9 Left 1058054313 9:100434211-100434233 CCTGCTCATTTCTTCCTTTGAAA 0: 1
1: 0
2: 5
3: 81
4: 558
Right 1058054316 9:100434225-100434247 CCTTTGAAACAGTCTTTGGCTGG No data
1058054310_1058054316 18 Left 1058054310 9:100434184-100434206 CCTACCCTACTGTGGACACATAT 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1058054316 9:100434225-100434247 CCTTTGAAACAGTCTTTGGCTGG No data
1058054308_1058054316 20 Left 1058054308 9:100434182-100434204 CCCCTACCCTACTGTGGACACAT 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1058054316 9:100434225-100434247 CCTTTGAAACAGTCTTTGGCTGG No data
1058054311_1058054316 14 Left 1058054311 9:100434188-100434210 CCCTACTGTGGACACATATACAT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 1058054316 9:100434225-100434247 CCTTTGAAACAGTCTTTGGCTGG No data
1058054312_1058054316 13 Left 1058054312 9:100434189-100434211 CCTACTGTGGACACATATACATC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1058054316 9:100434225-100434247 CCTTTGAAACAGTCTTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058054316 Original CRISPR CCTTTGAAACAGTCTTTGGC TGG Intronic
No off target data available for this crispr