ID: 1058058613

View in Genome Browser
Species Human (GRCh38)
Location 9:100473441-100473463
Sequence GCGGCTGCTAGGAGGCACCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058058608_1058058613 -8 Left 1058058608 9:100473426-100473448 CCCCGGCTCAGCGGCGCGGCTGC 0: 1
1: 0
2: 0
3: 19
4: 120
Right 1058058613 9:100473441-100473463 GCGGCTGCTAGGAGGCACCGAGG 0: 1
1: 0
2: 1
3: 8
4: 114
1058058610_1058058613 -10 Left 1058058610 9:100473428-100473450 CCGGCTCAGCGGCGCGGCTGCTA 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1058058613 9:100473441-100473463 GCGGCTGCTAGGAGGCACCGAGG 0: 1
1: 0
2: 1
3: 8
4: 114
1058058609_1058058613 -9 Left 1058058609 9:100473427-100473449 CCCGGCTCAGCGGCGCGGCTGCT 0: 1
1: 0
2: 3
3: 16
4: 135
Right 1058058613 9:100473441-100473463 GCGGCTGCTAGGAGGCACCGAGG 0: 1
1: 0
2: 1
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058058613 Original CRISPR GCGGCTGCTAGGAGGCACCG AGG Exonic
900287702 1:1909327-1909349 GCCGCCGCTAGGACGCACGGCGG + Intergenic
904493291 1:30873183-30873205 GAGGCTGCAGGGAGGCACTGTGG + Exonic
904500171 1:30908655-30908677 GCGGCTGCTTGGCGGCGGCGCGG + Exonic
905137287 1:35808817-35808839 CCGGCTGGTAGTAGGCAGCGGGG - Intronic
907038417 1:51236598-51236620 GCGGCCCCTCGGCGGCACCGTGG + Exonic
910767627 1:90798144-90798166 GTGACTGCAAGCAGGCACCGGGG - Intergenic
912262269 1:108121881-108121903 GAGGCTGGGAGGAGGCACCTGGG - Intergenic
912756061 1:112325659-112325681 GCAGCTGCTCAGAGGCAGCGTGG - Intergenic
917296293 1:173522823-173522845 GTGGGTGCAAGGAGGCCCCGAGG - Intronic
1067103678 10:43351043-43351065 GCGGCTGCGTGCGGGCACCGAGG - Intergenic
1068096630 10:52499457-52499479 GCGGCTGCTGGGAGGGATGGGGG + Intergenic
1072614261 10:97038963-97038985 AGGGCTGCTAGGAGGCTCCAAGG + Intronic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1074392626 10:113070911-113070933 GTGGCTACTAGGAGACACGGGGG - Intronic
1074543743 10:114386661-114386683 GCAGCTGCCAGGAGGCCCAGGGG + Intronic
1074720161 10:116257184-116257206 TCGGCTGCTAGGAGGCATTTTGG - Intronic
1075521949 10:123148461-123148483 GGGGCCCCTCGGAGGCACCGCGG + Exonic
1081549117 11:44095951-44095973 GCGGCCGCGCGGAGGCTCCGTGG + Intronic
1083753704 11:64778098-64778120 GCGGCGGGTACGAGGCGCCGGGG + Exonic
1084547042 11:69819657-69819679 GCGGCGGCAGGGAGGCTCCGGGG + Intergenic
1085084179 11:73655816-73655838 GCGGCTCCTGGGAGGGACGGTGG - Exonic
1088500628 11:110478843-110478865 GGGACTGCCTGGAGGCACCGAGG + Intergenic
1089466575 11:118689881-118689903 GGGGCTGCTGGGAGGCAGAGCGG - Intergenic
1095989599 12:48025584-48025606 GCGGGGGCTGGGAGGCACCCTGG - Intergenic
1097218187 12:57430624-57430646 GCGGGCGCGAGGAGGCCCCGCGG - Intronic
1100985672 12:100199885-100199907 GCGGCGGGAAGGGGGCACCGCGG - Intronic
1103318682 12:120077419-120077441 GCAGCTGCTAGGATGCAGGGGGG + Intronic
1104317813 12:127720528-127720550 GCGGCTGCGTGGACGCACCATGG + Intergenic
1104970904 12:132530274-132530296 CCGGCTGCTGGGAGGCACCTGGG + Intronic
1105947618 13:25203027-25203049 GCGGCTGCCAGGAAGCCCTGAGG + Intergenic
1112452672 13:99526203-99526225 GCGGCTGCTAGGCTGCATCAGGG + Intronic
1113462620 13:110492535-110492557 GGGGCTGTAAGGAGGCCCCGGGG - Intronic
1122967356 14:105137646-105137668 GCGGCAGCTAGGCGGCACCGGGG - Intergenic
1123413004 15:20074429-20074451 GCAGCTGCGCGGCGGCACCGGGG - Intergenic
1123522346 15:21081542-21081564 GCAGCTGCGCGGCGGCACCGGGG - Intergenic
1128982376 15:72197219-72197241 GCGGCTGCGGGGAGGCAGCTCGG - Intronic
1129790679 15:78338932-78338954 GTTGCTGCCAGGAGGCTCCGAGG - Intergenic
1132499900 16:280638-280660 GCGGCTCCTCGGCGGCTCCGCGG + Exonic
1132558657 16:583735-583757 CCTGCTGCTACGGGGCACCGTGG - Exonic
1135821967 16:25692687-25692709 GCGGCTGCGAGGGGGCGCCGAGG - Exonic
1136784236 16:32925309-32925331 GCGGCTCCTGGTAGGCAGCGTGG + Intergenic
1136885548 16:33928497-33928519 GCGGCTCCTGGTAGGCAGCGTGG - Intergenic
1137491816 16:48939256-48939278 GTGGCTACTAGGAGACACAGAGG - Intergenic
1140478774 16:75251577-75251599 GCAGCTGCGCGGCGGCACCGGGG - Intronic
1140949274 16:79800590-79800612 GGGGCTGCTAGGAGCCACTGTGG - Intergenic
1141387088 16:83631717-83631739 GGAGCTGCTAGGAGTCACCAAGG - Intronic
1142086710 16:88187030-88187052 GGGGCGGCTGGGAGGCCCCGGGG + Intergenic
1142196027 16:88739697-88739719 GGGGCTGCTGGGAGGCTCCGAGG + Intronic
1142380292 16:89728107-89728129 GCAGGTGCCAGGAGGCACCTGGG + Intronic
1145000270 17:19300077-19300099 GGGGCAGCTAGGTGGCACCTAGG - Intronic
1147179508 17:38675110-38675132 GCGGCGGCTGGGAGGGAGCGCGG + Exonic
1150373585 17:64662150-64662172 GCGGCCGCGAGGAGGCGGCGGGG - Intergenic
1152684649 17:81688103-81688125 GCTGCTGCAAGCAGGCTCCGGGG - Intronic
1154274381 18:12947253-12947275 GGGGGTGCTAGGAGCCACCACGG - Intronic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1161237166 19:3203923-3203945 GGGGCAGCCAGGAGGCACAGAGG + Intronic
1162042352 19:7978486-7978508 GCACCTGCCAGGAGGCTCCGTGG - Intronic
1162990373 19:14298102-14298124 GCGGCTGCTGGGAGCCAGAGAGG + Intergenic
1168339326 19:55614495-55614517 GCGGGTGCTGGGAGGCCCAGCGG - Exonic
925384570 2:3453235-3453257 GCGCCTGCTGGGAAGTACCGGGG - Intronic
925534436 2:4901304-4901326 GCTGCTGCTATGAGGGACAGTGG - Intergenic
925975221 2:9137646-9137668 GAGGCTGTCAGGAGGCACCCTGG - Intergenic
926205094 2:10830129-10830151 GCGGGTGCAAGGAGGCAGTGTGG - Intronic
927240077 2:20913604-20913626 GAGGCTGCTAGGGGACACAGTGG - Intergenic
941100186 2:161286574-161286596 CCAACTGCTAGGAGGCAGCGAGG + Intergenic
941627406 2:167844891-167844913 GGGGCTGTTAGGGGGCACAGTGG + Intergenic
943018658 2:182546252-182546274 GCTGTTGCTAGGATGCACCAGGG + Intergenic
944264069 2:197705426-197705448 CCGCCTGCTAGGACGCACGGGGG + Exonic
946404111 2:219483682-219483704 GCTGCTGCGGGGAGGCCCCGAGG + Exonic
948571848 2:238922609-238922631 GCTGCTGCAAAGAGGCCCCGAGG - Intergenic
948775508 2:240286775-240286797 CCTGCTGCTAGGAGGCATAGAGG - Intergenic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
949031428 2:241799184-241799206 GGGGCTGTTAGGAGGTACCCGGG - Intronic
1169088314 20:2840741-2840763 ACGGCAGCTGGGAAGCACCGAGG - Exonic
1169220592 20:3820250-3820272 GCGGCCGCGAGGGGGCGCCGCGG - Intergenic
1174342493 20:49906546-49906568 GCGGCTGCTCGGACGCCCTGCGG - Exonic
1175902495 20:62365676-62365698 GGGGCAGCCAGGAGGCACCCAGG + Intronic
1181085178 22:20436549-20436571 GGGGCTGCGAGGGGGCAGCGCGG - Intronic
1182480770 22:30607323-30607345 GCTGCTGCCATGAGGCACCTTGG + Exonic
1182775432 22:32827988-32828010 GCAGGTGCTAGGAGGCAAAGGGG - Intronic
1183373671 22:37449853-37449875 GGGGCTGCTAGGAAACCCCGTGG - Intergenic
1183440206 22:37818683-37818705 GCGGCTCCTGGGAGCCACAGGGG - Intergenic
1184593733 22:45502499-45502521 CCGGCTGCTGGGGGGCACTGGGG - Intronic
953984520 3:47431104-47431126 GAAGCTGCTGGGAGGCACAGAGG + Intronic
957555653 3:81761760-81761782 GGAGCGGGTAGGAGGCACCGAGG + Exonic
961216484 3:125164214-125164236 GCGGGTGCCAGGGGGCACCAGGG + Intronic
961405902 3:126679409-126679431 GCGGCCGCGAGGTGGCACTGCGG + Intergenic
963511115 3:146250843-146250865 GCGCCTGCCCGCAGGCACCGCGG + Intronic
967392573 3:188971684-188971706 GCAGCTGCTGAGAGGCACCCAGG - Intronic
967970240 3:194994148-194994170 GGGGCAGCTGGGAGGCAGCGAGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969722135 4:8898005-8898027 GTGGCAGGGAGGAGGCACCGAGG - Intergenic
979349681 4:119629029-119629051 GCGGCTGGAAGGAGGCCGCGCGG + Intergenic
981660277 4:147158355-147158377 CTGGCTGTCAGGAGGCACCGCGG + Intergenic
984019571 4:174468610-174468632 GAGGCTGCAGGGAGGCACCCAGG + Intergenic
984755909 4:183325287-183325309 GCGCCTGCTAGGAGGAAGGGCGG - Intergenic
990981201 5:61603837-61603859 GTGACTGCTAGGAGCCACCACGG + Intergenic
991674101 5:69075169-69075191 GCGGGTGCTGGAAGGCACCGCGG - Intergenic
1002897669 6:1389112-1389134 GCGGCTGCTCGGAGCCTCCCTGG - Intergenic
1003256844 6:4482553-4482575 GATGCTGCTGGGAGGCGCCGGGG + Intergenic
1006610608 6:35292279-35292301 GGGGCTGGTAGGGGGCACTGGGG - Intronic
1009893670 6:69720884-69720906 GCGGCAGCCATGAGGCACCATGG + Intronic
1010000532 6:70944488-70944510 GCGACTGCAAGGCGGCAGCGAGG + Intronic
1018773028 6:166988871-166988893 GCAGCTGCAAGGAGGTACCCAGG - Intergenic
1018978197 6:168581772-168581794 GGGGCTGCAGGGAGGCAGCGGGG - Intronic
1019082107 6:169441435-169441457 GCGGCAGGTGGGAAGCACCGAGG + Intergenic
1019731819 7:2632952-2632974 CCGGCGGCCAGGAAGCACCGTGG + Intronic
1022132993 7:27421236-27421258 GCTGCTGGTAGCAGGCACAGTGG + Intergenic
1026817200 7:73522145-73522167 GGGGCTGCTGGGAGGCGCGGCGG - Exonic
1026879511 7:73899878-73899900 GGCGCTGGCAGGAGGCACCGTGG - Intergenic
1036802357 8:11802287-11802309 CCGGCTGGCAGGAGCCACCGAGG + Exonic
1039880108 8:41620307-41620329 GCTGCTGCAGGGAGGCACGGGGG + Intronic
1049635241 8:143684643-143684665 GCGGCTGCTGGGACAGACCGGGG + Intronic
1050151566 9:2622813-2622835 GCGGCGGCCGGGAGGCTCCGCGG + Intronic
1056396292 9:86184354-86184376 GCGGCTGCAAGGGGGCACTGTGG + Intergenic
1058058613 9:100473441-100473463 GCGGCTGCTAGGAGGCACCGAGG + Exonic
1060408193 9:123382981-123383003 GGGCCTGGTAGGAGGCACCTTGG + Intronic
1060700672 9:125747128-125747150 GCGGCGGCGAGGAGGCGGCGCGG + Intergenic
1061411136 9:130422363-130422385 GAGGCTGTTAGGAGGAACCCTGG - Intronic
1061957509 9:133971329-133971351 GCAGCCGCAAGCAGGCACCGTGG + Intronic
1062074195 9:134575605-134575627 GAGGCTGCAGGGAGGCACCCAGG - Intergenic
1062707515 9:137953619-137953641 GAGGCTTGGAGGAGGCACCGGGG + Intronic
1185684599 X:1917918-1917940 GCAGCTGCAAGGAGGTACCAGGG - Intergenic
1189307036 X:39994665-39994687 CTGGCTGCTAGCAGGCACCATGG - Intergenic