ID: 1058058651

View in Genome Browser
Species Human (GRCh38)
Location 9:100473593-100473615
Sequence GTGTAGCAGCAGAAGGCGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058058651_1058058655 14 Left 1058058651 9:100473593-100473615 CCGCTCGCCTTCTGCTGCTACAC 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058058655 9:100473630-100473652 TCTTCGCCTTCTCTCTGCCCGGG 0: 1
1: 0
2: 4
3: 30
4: 329
1058058651_1058058654 13 Left 1058058651 9:100473593-100473615 CCGCTCGCCTTCTGCTGCTACAC 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058058654 9:100473629-100473651 CTCTTCGCCTTCTCTCTGCCCGG 0: 1
1: 0
2: 3
3: 45
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058058651 Original CRISPR GTGTAGCAGCAGAAGGCGAG CGG (reversed) Exonic
902903328 1:19535319-19535341 GTGCAACAGTAGAAGGCCAGTGG - Intergenic
904785994 1:32983429-32983451 GTCTAGCAGAAAAAGGCCAGAGG - Intergenic
906241289 1:44243693-44243715 CTGTAGCAGCAGAGAGGGAGTGG + Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
909635731 1:77814954-77814976 GTACAGCAGCAGAAGTCAAGAGG - Intronic
917588459 1:176452464-176452486 GTGTAGCAGGAGAGGCAGAGAGG + Intergenic
918739957 1:188117074-188117096 GTGTAACAGTAGAAGGTGATGGG - Intergenic
920543077 1:206793898-206793920 GAGTAGCAGGGGAAGGAGAGTGG + Intergenic
920562525 1:206948748-206948770 GTCTAGCAGGAGGATGCGAGGGG + Intergenic
921856154 1:219987159-219987181 GTGGAGCAGGAGAAGGGCAGGGG - Exonic
922159702 1:223070088-223070110 GTGTAGCAGAGGAAGGCCAGAGG - Intergenic
923667522 1:236011989-236012011 GTGTTGTAGCAGAAGGCGTCAGG + Exonic
924067967 1:240245790-240245812 GTGAAGCAACAGAAGGCCTGGGG - Intronic
924615288 1:245607264-245607286 GTGTGTCAGCAGAGGGTGAGTGG + Intronic
1064035831 10:11912734-11912756 TTGTTGCAGCAGAAGCCCAGAGG - Intergenic
1065426316 10:25608006-25608028 CTGTAGAAGCAGAATGCAAGGGG - Intergenic
1065588362 10:27241441-27241463 GAGGAGCAGCCGAAGGAGAGAGG + Intronic
1066406955 10:35127291-35127313 GTGGAGCAGCAGAGGCCGAGCGG + Intronic
1071492413 10:86144719-86144741 GTGAAGGAGGAGAAGGGGAGCGG - Intronic
1071918088 10:90318854-90318876 GTGTAGCAGTAGCAGGAAAGGGG + Intergenic
1072288551 10:93940800-93940822 GAGGAACAGCAGAAGGCGAAAGG - Intronic
1072430810 10:95369211-95369233 GTGGAACAGGAGAAGGGGAGAGG - Intronic
1073257117 10:102159912-102159934 GTGGGGGAGCAGAAGGCGGGGGG - Exonic
1073374540 10:103021625-103021647 GGGAAGCAGCAGAAGTCAAGAGG - Intronic
1074376682 10:112946723-112946745 GAGAAGCAGCAGAAGGGCAGTGG + Intergenic
1076901897 10:133343442-133343464 GGGAGGCAGCAGAAGGCCAGTGG - Intronic
1078393231 11:10954768-10954790 GTGGAGCAGAAGAAAGAGAGAGG - Intergenic
1079539954 11:21561281-21561303 GTGTGGCAGATGAAGGCAAGTGG - Intronic
1083696127 11:64443887-64443909 CTGTAGGAGCAGAAGTCCAGTGG + Intergenic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1088989311 11:114938025-114938047 GTGGAGCAGGAGAAAGAGAGAGG - Intergenic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090509770 11:127362913-127362935 GTGGAGCAGCAGAGGAGGAGAGG - Intergenic
1091356867 11:134944115-134944137 GGGAAGCAGGAGAAGGGGAGGGG + Intergenic
1092955790 12:13548502-13548524 GTGTAGCAGAAGACAGGGAGTGG + Exonic
1094041066 12:26122434-26122456 CGGCAGCTGCAGAAGGCGAGAGG + Exonic
1094627139 12:32134990-32135012 GTGTGGCATCAGAGGGCTAGAGG + Intronic
1094719040 12:33043516-33043538 GACTAGCAGGAGGAGGCGAGAGG + Intergenic
1096541957 12:52313056-52313078 GGGTGGTAGCTGAAGGCGAGAGG + Intergenic
1096620202 12:52859779-52859801 GTGTTGCAGCAGAGTGGGAGCGG - Intergenic
1102783233 12:115583674-115583696 GTGTTTCAGCAGAAGGAAAGTGG - Intergenic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1108049977 13:46424157-46424179 GGGTAGCAGCAGAAACCCAGCGG - Intronic
1109542496 13:63797445-63797467 GGGTAGCAGCAGAAACCTAGCGG - Intergenic
1110308655 13:74021006-74021028 GTGTAGTAGCAGACGTCGAGGGG - Intronic
1110703705 13:78579965-78579987 GTGAAGCTGAAGAAGGCAAGGGG + Intergenic
1114155601 14:20099518-20099540 GTGGAGCAGGAGCAGGGGAGCGG - Intergenic
1114547671 14:23514269-23514291 GTGGAGCAACAGACGGAGAGTGG + Intergenic
1116951381 14:50881776-50881798 GTGTAGGAGCAGAAGTCCACCGG - Intronic
1118355508 14:65010306-65010328 GTGAAGCCACAGAAGGTGAGAGG - Intronic
1118849549 14:69573428-69573450 GTGCAGCCGCAGAAGGCGGGCGG - Exonic
1122769499 14:104091730-104091752 GTACAGCTGCAGAGGGCGAGGGG + Intronic
1123066148 14:105620375-105620397 GTGTGGCTGCAGGAGGCGGGGGG + Intergenic
1123070291 14:105639428-105639450 GTGTGGCTGCAGGAGGCGGGGGG + Intergenic
1123074881 14:105663087-105663109 GTGTGGCTGCAGGAGGCGGGGGG + Intergenic
1123089528 14:105736212-105736234 GTGTGGCTGCAGGAGGCGGGGGG + Intergenic
1123095316 14:105764372-105764394 GTGTGGCTGCAGGAGGCGGGGGG + Intergenic
1125331751 15:38589392-38589414 GGGTACCTGCAGGAGGCGAGGGG + Intergenic
1125480420 15:40075514-40075536 GTGGGGCAGCAGAAGGGCAGAGG + Intergenic
1125553457 15:40565148-40565170 GAGGAGCAGCAAGAGGCGAGCGG + Intergenic
1128581636 15:68814519-68814541 GTGCAGCAGCAGCAGGAAAGAGG + Intronic
1128809274 15:70558535-70558557 GTGGAGCAGCAGTAGGAGGGAGG - Intergenic
1131478438 15:92761692-92761714 CAGTAGCAGCAGAAGCCTAGTGG + Intronic
1134872782 16:17666877-17666899 GTGTAACAACAGAAGGAGAGGGG - Intergenic
1136526453 16:30834470-30834492 GTGGTGCTGCAGAAGGCGGGAGG + Exonic
1136569096 16:31086299-31086321 GAGAAGGAGCAGAAGGGGAGGGG - Intronic
1138280881 16:55771395-55771417 GTGTGGCAGCAGCAGCTGAGTGG - Intergenic
1138287646 16:55822467-55822489 ATGTGGCAGCAGAAGCTGAGTGG + Intronic
1138782234 16:59802851-59802873 GTGTAGCAGTAGAGGGCTAATGG + Intergenic
1140970495 16:80007802-80007824 TTTTAGCAGCAGAAGGCGAATGG - Intergenic
1141001047 16:80308202-80308224 GGGCAGCAGAAGAAGGAGAGAGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141172511 16:81700336-81700358 GAGGAGCAGCAGCAGGTGAGGGG - Intronic
1144282171 17:13737034-13737056 GTGAATCAGCAGAAGCCTAGGGG + Intergenic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1151484180 17:74388175-74388197 GGGCAGGAGCAGAAGGAGAGAGG + Intergenic
1151566463 17:74901237-74901259 GGGTAGCCGCAGAAGGCCAAGGG - Intergenic
1153992708 18:10414424-10414446 GAGTACCAGCAGAAGCCGCGTGG - Intergenic
1154497798 18:14975186-14975208 GGGAAGCAGGAGAAGGGGAGGGG - Intergenic
1158894601 18:61901173-61901195 CTGGAGCAGCAGGAGGGGAGGGG - Intergenic
1160991423 19:1861869-1861891 GTGGAGCAGCCGAAGGGAAGTGG - Intronic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1166885965 19:45961051-45961073 GTGCAGCTGCAGAAGGAGACCGG - Exonic
928436352 2:31257104-31257126 AAGGAGCAGCAGAAGGCCAGAGG + Intronic
940249575 2:151659940-151659962 TTGTAGCAGAAAAAGGCTAGAGG - Intronic
941431664 2:165421479-165421501 GTGTGGTAGCAGAAGCTGAGAGG - Intergenic
941697995 2:168573758-168573780 GTGGAGCAGGAGTAGGTGAGGGG + Intronic
942017277 2:171829584-171829606 GGGAAGCAGCAGGAGCCGAGGGG + Intronic
947795881 2:232893794-232893816 GTGCCGCAGCAGAAGCCCAGGGG + Intronic
947829383 2:233128044-233128066 GGGTGGCAGCAGGAGGTGAGCGG + Intronic
1170445054 20:16417921-16417943 TTGTAGTCGCAGAAGGAGAGGGG + Intronic
1172744628 20:37197110-37197132 GTATAGCTGCAGGAGGCTAGAGG + Intronic
1177577371 21:22975942-22975964 GTGGAGCTGCAGAAGGCCATGGG - Intergenic
1182085871 22:27560892-27560914 TGGTAGCAGCAGGAGGCAAGTGG + Intergenic
1182355572 22:29720987-29721009 GGGCAGCAGCAGAAGGGGAGAGG + Intronic
1183981270 22:41541928-41541950 GTGGAGCATCAGAAGGTGATGGG - Intronic
1184513023 22:44944050-44944072 GTGGAGCAGCAGGAGGGTAGAGG - Intronic
1184806279 22:46796724-46796746 GGGCAGCAGCAGAGGGCGGGAGG + Intronic
952027677 3:29102907-29102929 GGGAGGCAGCAGAAGGAGAGAGG - Intergenic
953363936 3:42325633-42325655 TTGTAGAAGCAAAAGGAGAGAGG - Intergenic
954199443 3:49015421-49015443 GTGCAGGAGCTGAAGGTGAGTGG + Exonic
954463284 3:50639814-50639836 GTGTAGAAGCAGAAGGTGCTGGG - Intronic
957501728 3:81066637-81066659 GGGTAGCAGGAGAAAGCCAGGGG - Intergenic
960078657 3:113516506-113516528 TTGTAACAGCAGAAAGCAAGGGG - Intergenic
960269540 3:115658892-115658914 GGGTGGGAGCTGAAGGCGAGCGG - Intronic
961945497 3:130682666-130682688 GAGTAGCAGTAGAAGGCATGAGG - Intronic
966207560 3:177420508-177420530 ATGTAGCAGAAGAAGGCGGGAGG - Intergenic
969295642 4:6269538-6269560 CTGTTACAGGAGAAGGCGAGCGG + Intergenic
969475116 4:7417937-7417959 GTGAGCCAGCAGAAGGCTAGAGG + Intronic
973849356 4:54945924-54945946 CTGAAGCAGGAGAGGGCGAGAGG - Intergenic
973981287 4:56310266-56310288 GTGTGGCTGGAGAAGGGGAGAGG + Intronic
974638209 4:64592666-64592688 GGGTAGAAGCAGAAGAGGAGAGG + Intergenic
975682592 4:76891262-76891284 GTGCAGCAGCAAAAGGCTAATGG + Intergenic
976089949 4:81446792-81446814 GTTTTGCAGTAGAAGGCTAGTGG - Intronic
978269920 4:106876663-106876685 GTGGAGCAGGAGAGGGAGAGGGG - Intergenic
978643050 4:110893802-110893824 GTGTATTAGCAGAAGGGAAGGGG + Intergenic
982358092 4:154491057-154491079 GCGCAGCAGCAGGAGGGGAGCGG - Intronic
985560041 5:580639-580661 AAGTCACAGCAGAAGGCGAGAGG + Intergenic
985880288 5:2634151-2634173 GTGGAGCTGCAGAAGGCAGGCGG + Intergenic
985894475 5:2740297-2740319 TTGGGGCCGCAGAAGGCGAGCGG + Intergenic
986029512 5:3881683-3881705 GTTTTGCAGCAGAAGCTGAGGGG - Intergenic
989285249 5:39691863-39691885 CTGTAGCATCAGAAGCCTAGTGG - Intergenic
991917359 5:71618357-71618379 GTGGAACAGCAGAAGGTGGGAGG - Intronic
992365079 5:76083047-76083069 TTGTAGCAGGTGAAGGAGAGGGG - Intergenic
993874996 5:93296029-93296051 GTTTAGCAGCAGAATTAGAGAGG + Intergenic
998860865 5:146442709-146442731 ATGTGGCAGAAGAGGGCGAGAGG + Intergenic
999953435 5:156674598-156674620 GTCAAGCATCAGAAGGAGAGAGG + Intronic
1000859817 5:166443898-166443920 CAGTAGCAGCAGAAGGCAAGAGG - Intergenic
1001102181 5:168823459-168823481 GTGGAGCAGCTGAAGACAAGTGG + Intronic
1006148035 6:31970837-31970859 GAGAAGCAGCAGCAGGCGTGGGG + Intronic
1006335340 6:33417624-33417646 GGGTAGCAACAAAAGGCGGGAGG + Exonic
1008603221 6:53116074-53116096 CTGTAGTAGCAGAAGGCGCCAGG - Intergenic
1011623414 6:89263838-89263860 GTGTAGCTGCAGAAGGAAATTGG - Intronic
1012828668 6:104179600-104179622 GTGGCACAGCAGAAGGTGAGCGG - Intergenic
1015737879 6:136420374-136420396 GTGCAGCACCAGGAGGCCAGGGG + Intronic
1015883576 6:137893329-137893351 CTAGAGCAGCAGAAGGGGAGGGG - Intergenic
1016697560 6:147015809-147015831 GTGTAGCAGCACAAGGACATGGG - Intergenic
1016754963 6:147674827-147674849 GGGAAACAGCAGAAGGAGAGTGG - Intronic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1019135058 6:169902727-169902749 GTGTAGCTGTAGAAGGGGATGGG - Intergenic
1019723556 7:2587863-2587885 GTGGAGCTGGAGAAGGTGAGCGG + Exonic
1022142993 7:27509361-27509383 GTGTAGCAGCAGAAGCCATGAGG + Intergenic
1027172555 7:75883058-75883080 GTGTAGCAGGATAAGGCAGGAGG - Intronic
1029849272 7:103445831-103445853 GTGGAGCTGCAGAGGGCAAGGGG + Intronic
1032525037 7:132573621-132573643 GAGTAGCAGCAGCAGGCGACAGG + Intronic
1033845578 7:145427910-145427932 GTGTATCAGCAGAAACCAAGTGG + Intergenic
1034883737 7:154781813-154781835 GTGTGGCAGTAAAGGGCGAGGGG - Intronic
1035093820 7:156335723-156335745 GTGAAGCAGCAGAATGTGTGAGG - Intergenic
1037763959 8:21760329-21760351 CTGAAGCAGCAGAAAGCTAGTGG + Intronic
1037809853 8:22080856-22080878 GTGCTGGAGCAGAAGGTGAGGGG + Exonic
1039823592 8:41154873-41154895 GTTTAGCAGGGGAAGGAGAGAGG + Intergenic
1039943690 8:42112357-42112379 GTGTAGCACAAGAAGACGACTGG + Intergenic
1041180214 8:55239536-55239558 GTGGGGCAGCAGAAGGAGAGTGG - Intronic
1041266581 8:56071541-56071563 GGGTAACAGCAGTAGGGGAGGGG + Intronic
1045300125 8:100903621-100903643 GTGGAGAAGCAGAGGGCGATAGG - Intergenic
1048194614 8:132322034-132322056 GTGTGGCAGAAGAAGGAGAGCGG + Intronic
1049159404 8:141087634-141087656 GTGTGGCAGCAGGAGGTGGGTGG + Intergenic
1058058651 9:100473593-100473615 GTGTAGCAGCAGAAGGCGAGCGG - Exonic
1058865631 9:109159793-109159815 GTGTAGCAGCAGATGGCCTTTGG + Intronic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1061396379 9:130346079-130346101 CGGTAGCAGCAGAAGGCGGGTGG + Intronic
1062104218 9:134743985-134744007 GTGTAGCACCAGCAGGCCATGGG - Intronic
1195908213 X:109865665-109865687 AGGCAGCAGCAGAAGGCAAGTGG - Intergenic
1201677894 Y:16608139-16608161 GTGTCACAGCAGCAGGTGAGAGG - Intergenic