ID: 1058058807

View in Genome Browser
Species Human (GRCh38)
Location 9:100474115-100474137
Sequence CACACACAGATCCCTGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 385}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058058807_1058058813 0 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058813 9:100474138-100474160 TGTGTGCAGAGTGCGGTGGGTGG No data
1058058807_1058058820 19 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058820 9:100474157-100474179 GTGGGAGACGGCGAGGGGGCTGG No data
1058058807_1058058811 -4 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058811 9:100474134-100474156 TGTGTGTGTGCAGAGTGCGGTGG No data
1058058807_1058058822 23 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058822 9:100474161-100474183 GAGACGGCGAGGGGGCTGGGCGG No data
1058058807_1058058817 13 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058817 9:100474151-100474173 CGGTGGGTGGGAGACGGCGAGGG No data
1058058807_1058058815 7 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058815 9:100474145-100474167 AGAGTGCGGTGGGTGGGAGACGG No data
1058058807_1058058818 14 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058818 9:100474152-100474174 GGTGGGTGGGAGACGGCGAGGGG No data
1058058807_1058058810 -7 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058810 9:100474131-100474153 GTGTGTGTGTGTGCAGAGTGCGG No data
1058058807_1058058824 25 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058824 9:100474163-100474185 GACGGCGAGGGGGCTGGGCGGGG No data
1058058807_1058058821 20 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058821 9:100474158-100474180 TGGGAGACGGCGAGGGGGCTGGG No data
1058058807_1058058814 1 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058814 9:100474139-100474161 GTGTGCAGAGTGCGGTGGGTGGG No data
1058058807_1058058819 15 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058819 9:100474153-100474175 GTGGGTGGGAGACGGCGAGGGGG No data
1058058807_1058058825 30 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058825 9:100474168-100474190 CGAGGGGGCTGGGCGGGGTGAGG No data
1058058807_1058058816 12 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058816 9:100474150-100474172 GCGGTGGGTGGGAGACGGCGAGG No data
1058058807_1058058823 24 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058823 9:100474162-100474184 AGACGGCGAGGGGGCTGGGCGGG No data
1058058807_1058058812 -3 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058812 9:100474135-100474157 GTGTGTGTGCAGAGTGCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058058807 Original CRISPR CACACACAGATCCCTGCCTG GGG (reversed) Intronic
900103178 1:971431-971453 CCCACACAGCTGCCTCCCTGGGG - Intronic
900123177 1:1058267-1058289 CACACACAGGTCGCTGACGGTGG + Intergenic
900796904 1:4713414-4713436 CACACACAGTTCACTGGCTTTGG + Intronic
901879901 1:12187734-12187756 TTCACAAAGATCCCTGCCTCAGG - Intronic
903221859 1:21873713-21873735 CAGACACACATCCTAGCCTGCGG - Intronic
904087047 1:27916582-27916604 CACACACAAAGCCAGGCCTGTGG - Intergenic
905921144 1:41719732-41719754 GACACACAGAGCCCTTCCTCAGG + Intronic
907427295 1:54388425-54388447 CACACACAGTGCCTGGCCTGGGG + Intronic
907625568 1:56025890-56025912 AACACACACATCCCTGGGTGAGG + Intergenic
907632150 1:56093343-56093365 CACACACACATGCTTGCATGAGG - Intergenic
907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG + Intergenic
908080686 1:60574791-60574813 CACACACTGAGGCCTACCTGAGG - Intergenic
911094545 1:94044832-94044854 CTCTCACAGATTCCTGCCTGGGG + Intronic
912507439 1:110165848-110165870 AACACACACACCCCAGCCTGCGG - Intronic
912630637 1:111243816-111243838 CACACACATACACCTGCCTCTGG + Intergenic
915214033 1:154328532-154328554 CACACACACACCCCCGCCCGCGG - Intronic
917367411 1:174247638-174247660 CCCACACATATCCTTGCGTGTGG + Intronic
918520082 1:185405985-185406007 CTCAGACAGACCCATGCCTGAGG - Intergenic
918759603 1:188386354-188386376 CAGACACAGAGCCCTGATTGTGG + Intergenic
919056711 1:192580393-192580415 CACACACATATCCCTGTTTTGGG + Intergenic
919536716 1:198796843-198796865 CACACACAGAGCCCCCACTGGGG - Intergenic
920251894 1:204627480-204627502 AAGACAGAGATTCCTGCCTGGGG - Intronic
921049975 1:211504322-211504344 CACAGCCAGAAGCCTGCCTGGGG - Intergenic
922169875 1:223144994-223145016 CACAGGCAGAGCCCTGCCAGAGG + Intergenic
922935574 1:229419846-229419868 CACAGACACTTCCCTGGCTGGGG + Intergenic
924945370 1:248842920-248842942 CGCACACAGAGCACTCCCTGGGG + Intronic
1063920856 10:10931504-10931526 CTCACCCAGATCCCAACCTGTGG + Intergenic
1064318158 10:14277160-14277182 AACATTCAGATCCCAGCCTGGGG - Intronic
1064578903 10:16773524-16773546 CACACACAGATCACTTGCAGAGG + Intronic
1064968407 10:21038371-21038393 CACACACCGAGGCCTGCCAGGGG - Intronic
1065123213 10:22547786-22547808 CACACACAGATCGGTGTATGAGG - Intronic
1067578972 10:47427752-47427774 CACACACAGGTGCCTGTTTGGGG - Intergenic
1067852205 10:49761335-49761357 CACACACACAACCCTGTCTGGGG + Intronic
1068380704 10:56250484-56250506 CACACACTGAGGCCTGTCTGGGG - Intergenic
1068903339 10:62294961-62294983 CACACACATATATATGCCTGAGG - Intergenic
1069488553 10:68841991-68842013 CACACACACCTCCCTGGGTGCGG - Intronic
1070438147 10:76413728-76413750 CAGACAGACATCCCTGCCTTTGG - Intronic
1070775564 10:79107884-79107906 CAGGCACAGAGTCCTGCCTGAGG + Intronic
1071667368 10:87572833-87572855 CACACACTGTTCCCAGCCTCTGG - Intergenic
1071701951 10:87948542-87948564 CACACACACACCCCTGCCCAAGG - Intronic
1072129661 10:92481750-92481772 CCCACACAAATCCCTCCCTCTGG - Intronic
1072416386 10:95249968-95249990 CACCCACAGTTCCCTGCAGGTGG - Intronic
1072798716 10:98376726-98376748 CACACACAGATTTCTGCCTTTGG + Intergenic
1073214921 10:101830838-101830860 CACACACACACGCCGGCCTGGGG + Intronic
1074403519 10:113161867-113161889 CACAGACAGCCCTCTGCCTGTGG + Intronic
1075895514 10:125991215-125991237 CACACACTCATCCCTGCAGGAGG - Intronic
1076078087 10:127553581-127553603 CACACACAGCTCCTAGACTGGGG + Intergenic
1076511582 10:131018009-131018031 GACCCACAGCCCCCTGCCTGGGG + Intergenic
1077266034 11:1650750-1650772 CACCCAGAGGTTCCTGCCTGGGG + Intergenic
1078744293 11:14096557-14096579 CACCCACTGCTCCCTGCCAGTGG + Intronic
1080085251 11:28272549-28272571 CACACACTGGTGCCTGCCAGGGG + Intronic
1080664124 11:34320653-34320675 GACACCCATATGCCTGCCTGTGG - Intronic
1081367873 11:42258664-42258686 CACACACAGAATCCTGCCAAGGG - Intergenic
1082677886 11:56130928-56130950 CACACACTGGACCCTGTCTGAGG - Intergenic
1083197908 11:61102137-61102159 CCCACCCAGACCCCTGCCTCAGG + Intergenic
1084919230 11:72455709-72455731 TGCAAACAGATTCCTGCCTGAGG - Intergenic
1085346378 11:75770633-75770655 AAGACACAGCTCCCAGCCTGTGG - Intronic
1085884966 11:80511063-80511085 CACACACTGGGGCCTGCCTGGGG + Intergenic
1086605023 11:88685957-88685979 CCCACACAGAATCCTGACTGGGG + Intronic
1087710215 11:101540198-101540220 CACACAGAGAAGACTGCCTGAGG + Intronic
1088779764 11:113123042-113123064 CACACACCCTTCCCTGCCTCTGG - Intronic
1090593102 11:128293194-128293216 CAAACATTGATCCATGCCTGGGG - Intergenic
1091229892 11:133981469-133981491 CACACCCAGTCCCCTCCCTGAGG + Intergenic
1091341949 11:134822981-134823003 CCCAAAGAGCTCCCTGCCTGGGG + Intergenic
1093889086 12:24498033-24498055 CACACACTGAGGCCTGTCTGAGG + Intergenic
1095530576 12:43182190-43182212 CACACACAGAGTCCTCACTGGGG - Intergenic
1096532322 12:52249723-52249745 CAGACACAGAGACCTCCCTGTGG - Intronic
1096793355 12:54058939-54058961 CACACACACACCCCTAGCTGTGG - Intergenic
1096969185 12:55651816-55651838 CACACACAGATTCCCCACTGGGG + Intergenic
1097155690 12:57010614-57010636 CACACACACAGCCCTGCCCAAGG + Intronic
1097420408 12:59371627-59371649 CACACACACGTGCCTGCATGTGG - Intergenic
1097766493 12:63532816-63532838 CACACACACACCCCTGCCTTTGG + Intergenic
1097998420 12:65915379-65915401 CACATGCAGAGCCATGCCTGCGG + Intronic
1098325603 12:69298671-69298693 CACACACAGAGTCCTCACTGAGG + Intergenic
1098456817 12:70683731-70683753 CACACCAAGATCCCTGCCCTTGG - Intronic
1098479953 12:70945886-70945908 CACACACAGCTCACCGTCTGTGG - Intergenic
1098742334 12:74189526-74189548 CACACACACACCCCTGTGTGTGG + Intergenic
1101628071 12:106465622-106465644 CACACACCGAGGCCTGCCTGGGG - Intronic
1101837029 12:108303005-108303027 AACACTCCGATCCCTGCCTGGGG + Intronic
1102036328 12:109772352-109772374 CGCACACAGACCCCACCCTGTGG - Intergenic
1102200190 12:111052675-111052697 CACACACAGATCCCCACATGTGG - Intronic
1102974322 12:117195556-117195578 CACACACTCATGCCAGCCTGGGG + Intergenic
1104098668 12:125585266-125585288 TGCACACATAGCCCTGCCTGGGG + Intronic
1104328210 12:127819998-127820020 CTCATACACAGCCCTGCCTGGGG + Intergenic
1104443386 12:128813596-128813618 CTCACACATCTGCCTGCCTGCGG - Intronic
1104881162 12:132071509-132071531 CACACACAGCTGCCTGCCAATGG - Intronic
1105226747 13:18442056-18442078 CACACACAGAGACCTGTCAGGGG + Intergenic
1105247778 13:18667992-18668014 CACATACAGCTCACTCCCTGTGG - Intergenic
1105592642 13:21808956-21808978 CACACAAAGGTCCCTGTGTGAGG + Intergenic
1108930084 13:55807225-55807247 CACACACAGAGTCCTCACTGGGG - Intergenic
1111176466 13:84602664-84602686 CACACACACTTCCCAGCCTCTGG + Intergenic
1113709717 13:112455254-112455276 CACACACAGATGCTTCCCAGAGG + Intergenic
1113947920 13:114055066-114055088 CACACACAAACACGTGCCTGTGG - Intronic
1114011203 14:18370543-18370565 CACACACAGAGGCCTGTCAGGGG + Intergenic
1115043516 14:28960089-28960111 CACACACCGAGCCCTGTCTGGGG + Intergenic
1115089500 14:29556996-29557018 CCCAGAAAGGTCCCTGCCTGGGG - Intergenic
1116098877 14:40408271-40408293 CCCACACAGAGCCCTCACTGGGG - Intergenic
1117244127 14:53866610-53866632 CACACACAAATCTCTGTCTCAGG + Intergenic
1119773347 14:77235055-77235077 CACACACATAGCCATGCATGTGG - Intronic
1120839742 14:89074869-89074891 AACACACACATGCCTGTCTGGGG + Intergenic
1121865786 14:97361356-97361378 CACACACATATGCCTGCCTCCGG + Intergenic
1122429290 14:101629793-101629815 CACACCCACACCCATGCCTGTGG + Intergenic
1122826338 14:104372629-104372651 CCCACACAGGTCCCTGCCCACGG + Intergenic
1123038939 14:105482614-105482636 CCCACAAAGATGCCTGGCTGGGG - Intergenic
1123112676 14:105880512-105880534 CAAGCACAGAGCCCTGACTGAGG - Intergenic
1125537706 15:40452004-40452026 AACACACAGATCCCTGAGTGAGG - Intronic
1127402092 15:58598939-58598961 GACATACAGATCCCAGTCTGTGG - Intronic
1128703492 15:69821515-69821537 CACACACAGCCCTGTGCCTGAGG - Intergenic
1129168011 15:73790018-73790040 CACACACTGAGCCCTGACTCTGG - Intergenic
1129884553 15:79029469-79029491 CAAACACAGACCCCCACCTGGGG - Intronic
1130043309 15:80424242-80424264 AACCCAGAGAACCCTGCCTGAGG - Intronic
1130101906 15:80900574-80900596 CACACACACACCCCTACCTGGGG - Intronic
1130274255 15:82468386-82468408 CACACAGCCATCCCAGCCTGTGG - Intergenic
1130550509 15:84887613-84887635 CACAGCCAGAGCCCTGCCTGGGG - Intronic
1130588897 15:85200353-85200375 CACACAGCCATCCCAGCCTGTGG - Intergenic
1130722573 15:86403987-86404009 CACACACACATCCATGCCCAAGG + Intronic
1130836659 15:87656469-87656491 CACACACATGCCCATGCCTGGGG - Intergenic
1130903740 15:88225844-88225866 AAGGCACAGATCCCTTCCTGGGG + Intronic
1132041211 15:98525705-98525727 CACACACACACCCCTGCCCTGGG + Intergenic
1132400725 15:101503302-101503324 CCCACCCTGATCCCTGCCTCTGG + Intronic
1132744378 16:1430620-1430642 CACACACCGGGCCCTGGCTGGGG + Intergenic
1132956010 16:2594003-2594025 CACACACACATCCCATCCTGTGG - Intronic
1133232528 16:4373314-4373336 CGCACACACATGCCAGCCTGGGG + Intronic
1133421610 16:5651448-5651470 CACACACAGAATCCTGCCCCAGG + Intergenic
1135191774 16:20360310-20360332 AACACACAGCTCCTTGCCTTGGG - Intronic
1137667585 16:50260767-50260789 CGAACACAGATCCCTCCTTGGGG + Intronic
1138486010 16:57344131-57344153 AACACACAGGTCCTTACCTGGGG + Intergenic
1139579003 16:67860830-67860852 CAGACAGAGATCCTAGCCTGAGG - Intronic
1141848790 16:86629968-86629990 CACACAAAGACACCTGCCTCAGG - Intergenic
1141982224 16:87557598-87557620 CACACACAGATCCTGGACTCAGG + Intergenic
1142022034 16:87789856-87789878 CACCCACACAGCCCTGCATGAGG - Intergenic
1142225482 16:88875212-88875234 CACGCACAGATGCCAGGCTGCGG + Exonic
1143411629 17:6712927-6712949 GCCACACAGATCCCAGCCTTAGG - Intronic
1143523662 17:7460738-7460760 CACCCAAAGATCCCAGCCTAGGG - Exonic
1143555580 17:7657761-7657783 CATACACAGAGCCCTGTGTGTGG + Exonic
1145122651 17:20274350-20274372 CACTCACAGGACCCTGGCTGAGG - Intronic
1146671025 17:34737866-34737888 CACACACTGGGGCCTGCCTGGGG - Intergenic
1146722338 17:35132252-35132274 TTCCCACAGATCCCCGCCTGTGG - Exonic
1147689463 17:42306509-42306531 CACAGACAGGTTACTGCCTGGGG + Intronic
1147953453 17:44119730-44119752 CAAGCACAGATTCCTGTCTGGGG + Intronic
1148127630 17:45245115-45245137 GACACACAGATCCTTGGGTGTGG + Intronic
1148751088 17:49946315-49946337 CTCACACACCTCCCTGCCTCAGG + Intergenic
1148763535 17:50022117-50022139 CACACTGAGAGCCCTGCCTCTGG + Intergenic
1149525174 17:57350214-57350236 CACACACACACCCCTACCTCTGG - Intronic
1150635064 17:66907305-66907327 CAAACACAGAGCCAGGCCTGAGG - Intergenic
1150817057 17:68400648-68400670 CACACACAGAGCCCTGCACTTGG + Intronic
1151323992 17:73367836-73367858 CACCCACAAAGCCCTCCCTGAGG - Intronic
1153777471 18:8466610-8466632 CACACAGGGATCCCAGGCTGAGG - Intergenic
1153838948 18:8989213-8989235 CACACACAGATTCTCGCTTGAGG + Intergenic
1154056949 18:11021991-11022013 CAGACACAGATGTATGCCTGGGG - Intronic
1154335826 18:13463701-13463723 CACAGAAAGAGCCCTGCATGAGG + Intronic
1154441066 18:14391127-14391149 CACATACAGCTCACTCCCTGTGG + Intergenic
1154526636 18:15297418-15297440 CACACACAGAGACCTGTCAGGGG - Intergenic
1157239764 18:45998101-45998123 CACAAACAAAACCCTGGCTGAGG - Intronic
1157404771 18:47413679-47413701 CACACATCCATGCCTGCCTGAGG + Intergenic
1157621011 18:49017524-49017546 CACCCACAGATGCCGCCCTGTGG + Intergenic
1158310893 18:56156918-56156940 CACACACAGATGCCTGTCGTGGG + Intergenic
1158731145 18:60023803-60023825 ACCAAAAAGATCCCTGCCTGAGG + Intergenic
1160242580 18:77133633-77133655 CAGATCCAGATCCCTGACTGGGG - Intronic
1160264652 18:77330136-77330158 CACAAACAGGTCTCTGCATGTGG + Intergenic
1160569088 18:79804309-79804331 CACCCACTGATCACTGCATGGGG + Intergenic
1160827545 19:1087715-1087737 CACACACAGTCCGCGGCCTGGGG + Exonic
1161000530 19:1908467-1908489 CAGAGACACATCCCTGTCTGCGG + Intronic
1162123550 19:8486822-8486844 CACAGCCAGCTCCCTCCCTGGGG - Intronic
1162176447 19:8833079-8833101 CATACCCAGATCCCTGCCCCTGG - Intronic
1162181144 19:8869821-8869843 CACACACTGGGGCCTGCCTGAGG + Intronic
1164323730 19:24174177-24174199 CACAGACAGATACCAGTCTGTGG - Intergenic
1164423914 19:28122912-28122934 CACACACTCATCCCTGAGTGAGG + Intergenic
1164702475 19:30295651-30295673 GACACGCAGAGCCCTGCCTCTGG + Intronic
1164830401 19:31315518-31315540 CACACCCAGCTCCCTGGCAGAGG - Intronic
1165756047 19:38293565-38293587 CACACACAGAGCGCTGCAGGTGG - Intronic
1165978959 19:39703613-39703635 CACACACAGAAGCCTACTTGAGG + Intergenic
1165981180 19:39725670-39725692 CACACACAGGGGCCTGTCTGGGG + Intergenic
1166705785 19:44907263-44907285 CCCCCACACAGCCCTGCCTGGGG + Intronic
1167446278 19:49539468-49539490 CACAGACAAATCCCTTCTTGGGG + Intronic
1167498829 19:49834457-49834479 CACAGCAAGAGCCCTGCCTGAGG - Intronic
1167566201 19:50258851-50258873 CCCACCCACATCCCTCCCTGCGG + Intronic
1167738888 19:51312205-51312227 CAGACACCTAGCCCTGCCTGGGG + Intronic
1167958364 19:53086422-53086444 CACGCACAGATCTCACCCTGTGG + Intronic
1168349685 19:55668898-55668920 CACACACAGGGCACTGCCTCAGG - Intronic
926254779 2:11182226-11182248 CACACACAGCTGCATGTCTGAGG + Exonic
926633527 2:15158391-15158413 GACACAAAGGCCCCTGCCTGGGG + Intergenic
927037204 2:19190380-19190402 CACAGACAGAGCCATGCCAGGGG - Intergenic
928930410 2:36618217-36618239 CACACACACACCCATGCCTACGG - Intronic
929489115 2:42380807-42380829 TACACCCAGATCCTTGCCTCGGG - Intronic
932511753 2:72300081-72300103 GACTTAAAGATCCCTGCCTGAGG - Intronic
932708474 2:74045655-74045677 CACACACAGCCCCAGGCCTGAGG - Intronic
933507643 2:83199163-83199185 CACACACCGGGCCCTGCCAGGGG - Intergenic
933509381 2:83220416-83220438 CACACACACACCCCTAACTGAGG + Intergenic
933886186 2:86720660-86720682 CACGCACTGATCCATGCCGGAGG - Exonic
933923995 2:87076046-87076068 CACGCACTGATCCATGCCGGAGG + Intergenic
934864834 2:97798414-97798436 CACACACCGATCTATGCCAGGGG - Intronic
934911299 2:98257106-98257128 CACACACTCTTCCCTGCCTCTGG + Intronic
935149715 2:100422812-100422834 AACACAGAGATGCCTGGCTGCGG - Intergenic
936339468 2:111618380-111618402 CACGCTCAGATCCCTGTCTGGGG - Intergenic
936384175 2:112013745-112013767 CCCACACAGATCCCTGTGAGTGG + Intronic
937034104 2:118766271-118766293 CAAACACTGAAGCCTGCCTGTGG + Intergenic
937268107 2:120629957-120629979 CTCACACAGAGCACTGCCTAGGG - Intergenic
937274240 2:120673840-120673862 CACCCACAGAACCCTGCAGGAGG + Intergenic
938101338 2:128499933-128499955 ATAACACAGACCCCTGCCTGAGG - Intergenic
938166912 2:129037917-129037939 CACACACCGGGCCCTGTCTGGGG - Intergenic
938323447 2:130381099-130381121 CACACCCAGATTCCTGACTCAGG + Intergenic
938525729 2:132128783-132128805 CACACACAGAGACCTGTCAGGGG - Intergenic
939125408 2:138172186-138172208 CTCACACAGAGTCCTGACTGGGG + Intergenic
943757849 2:191575745-191575767 CACACACACACCCCTGGATGGGG + Intergenic
944019131 2:195079600-195079622 CACACACAGAGGCCTGTCTGGGG + Intergenic
944668136 2:201973351-201973373 CACACACAGATCCCTAGAGGTGG + Intergenic
946493794 2:220175397-220175419 AACTCACAGATGCATGCCTGAGG - Intergenic
948430695 2:237916658-237916680 CACACACACACCCCTGCCACTGG - Intergenic
1168771084 20:417381-417403 CACACACAAACCCCAGTCTGGGG - Intronic
1169264802 20:4161280-4161302 CAAACACAGCCCCCTGCATGAGG - Intronic
1170694371 20:18645349-18645371 TACACACAGATTTCTCCCTGCGG - Intronic
1170949643 20:20924973-20924995 CACACCAAAATCCCTGCCTCAGG + Intergenic
1171128899 20:22629865-22629887 TACACACTGTTCCCTTCCTGAGG - Intergenic
1173712611 20:45174055-45174077 CACACACACACCCCTACCTGTGG + Intergenic
1173723427 20:45279778-45279800 CACACACTGGGGCCTGCCTGAGG - Intergenic
1173916291 20:46710677-46710699 CACAAACTCATTCCTGCCTGAGG - Intronic
1174365270 20:50053004-50053026 CACCCCCACATCCCGGCCTGTGG + Intergenic
1175527476 20:59645436-59645458 CTCCCTCAGATCCCAGCCTGTGG + Intronic
1175988479 20:62776132-62776154 CACCCACAGCTCTCGGCCTGGGG + Intergenic
1176109394 20:63404583-63404605 CGCACTCATACCCCTGCCTGTGG + Intergenic
1176236220 20:64054773-64054795 AACAGACAGGTCCCTGCCTGTGG + Intronic
1176310172 21:5145179-5145201 CCCACACAAGGCCCTGCCTGTGG - Intronic
1176408868 21:6437036-6437058 CCCCCACAGCTCCCTGCTTGGGG + Intergenic
1176454990 21:6900051-6900073 CACATACAGCTCACTCCCTGTGG - Intergenic
1176570069 21:8405561-8405583 CACACACACATACCTACCTACGG - Intergenic
1176577980 21:8449768-8449790 CACACACACATACCTACCTACGG - Intergenic
1176770797 21:13071080-13071102 CACACACAGAGACCTGTCAGGGG + Intergenic
1176833163 21:13765099-13765121 CACATACAGCTCACTCCCTGTGG - Intergenic
1179032983 21:37736219-37736241 AAAACACAAATCCCTGCCAGGGG + Intronic
1179543577 21:42100121-42100143 CAGCCACAGATGCCAGCCTGGGG - Intronic
1179670409 21:42942956-42942978 CACACTCAGAACCCTGCTTAGGG + Intergenic
1179684362 21:43045358-43045380 CCCTCACAGCTCCCTGCTTGGGG + Intergenic
1179769439 21:43603451-43603473 AACAGACAGAACCCTGCCAGGGG + Intronic
1179846884 21:44116857-44116879 CCCACACAAGGCCCTGCCTGTGG + Intronic
1180435697 22:15301347-15301369 CACACACAGAGGCCTGTCAGGGG + Intergenic
1180517935 22:16165515-16165537 CACACACAGAGGCCTGTCAGGGG + Intergenic
1181902388 22:26167610-26167632 CACACACAGAGGCCTACCAGAGG + Intergenic
1182620326 22:31615144-31615166 CCCACACAGCCCCCTGCCTGGGG + Exonic
1183335732 22:37244851-37244873 CCCACACAGGCCCTTGCCTGGGG - Intergenic
1183404822 22:37625210-37625232 CACCCCCAGCTCCCTCCCTGGGG - Intronic
1183969779 22:41468385-41468407 CACCCCCCGATACCTGCCTGGGG + Intronic
1184373533 22:44097696-44097718 CACACATAGCTGCCTGCCTGGGG + Intronic
1184587170 22:45455769-45455791 CACCCAGAGAGCCCTGCATGGGG - Intergenic
1184656028 22:45942422-45942444 CACACACAGAGCTCAGGCTGGGG + Intronic
1184715135 22:46277709-46277731 GACAGACAGGTCCCAGCCTGTGG + Intronic
1185103203 22:48852724-48852746 CACACCCTGTCCCCTGCCTGGGG + Intergenic
1185416080 22:50711366-50711388 CACACACAAGTCCCTGCTTGTGG + Intergenic
1203256185 22_KI270733v1_random:139519-139541 CACACACACATACCTACCTACGG - Intergenic
951126992 3:18996059-18996081 CACACACAGAGTCCTTACTGGGG - Intergenic
951352327 3:21620972-21620994 CACACACATGTGCATGCCTGTGG - Intronic
951400277 3:22224803-22224825 CACCCACTGCTCCCTGCGTGGGG + Intronic
952356918 3:32593101-32593123 CACACACAGTTCCCCGGCTCAGG + Intergenic
953607032 3:44418953-44418975 CACAAACATATCCTGGCCTGGGG + Intergenic
954422439 3:50425780-50425802 CACATACATCTCCCTCCCTGGGG + Intronic
956745625 3:72308827-72308849 GACACCCACATCCCTGCCTCTGG - Intergenic
956875633 3:73459902-73459924 CACATCCAGATGTCTGCCTGTGG + Intronic
957405522 3:79770908-79770930 GACACATAGATCAATGCCTGTGG - Intergenic
958269455 3:91481233-91481255 CACACACAGTTCCATTTCTGTGG + Intergenic
959510643 3:107207825-107207847 CACAGGCACATCCCAGCCTGTGG + Intergenic
960234624 3:115267416-115267438 CACACACACACCCCTACCTATGG - Intergenic
960846383 3:122007823-122007845 CAGACACAGAACCCTGTCTATGG - Intronic
960915270 3:122688599-122688621 CCCACACTGATCCCTGACTATGG + Intronic
961503217 3:127352020-127352042 CAGACACATGTGCCTGCCTGAGG + Intergenic
961653802 3:128430472-128430494 CACACACAGATCTCTTGCCGGGG - Intergenic
961733868 3:128988102-128988124 CACACACACACTCCTGCCAGTGG - Intronic
964431838 3:156615602-156615624 CTCACACAGATCCTGGCATGGGG - Intergenic
964739712 3:159952607-159952629 GACACACAAGTTCCTGCCTGTGG + Intergenic
966442488 3:179961441-179961463 CACTCTCTGATCCCTGCCTCTGG - Intronic
966550313 3:181198033-181198055 CACACACTGAGGCCTGCCAGAGG + Intergenic
966593217 3:181703959-181703981 CACCCAGGGATCCCAGCCTGTGG + Intergenic
969568197 4:7992610-7992632 CACACACTGAGCTCTCCCTGGGG + Intronic
969570074 4:8003032-8003054 CAGACAAAGTTCCCTGTCTGGGG - Intronic
973126419 4:46591041-46591063 CACACACACACACCTGCCTGTGG - Intergenic
973608015 4:52606980-52607002 CACACTCATCTCCCTGCCTCTGG - Intronic
974171382 4:58270901-58270923 CCCACACAGAGTCCTGACTGGGG + Intergenic
974485123 4:62494489-62494511 CACACACAGAGCCCCCACTGGGG + Intergenic
975038119 4:69710025-69710047 CCCACACAGAGCCCTACTTGGGG - Intergenic
976468900 4:85404369-85404391 CAGACACATATCCCTGTCTGAGG - Intergenic
976969212 4:91083392-91083414 CACACACAGGAGCCTGCCGGGGG + Intronic
978830661 4:113080352-113080374 CACACACAAATCTCTTCCTTGGG - Intronic
979139191 4:117151113-117151135 CCCACACAGAGTCCTGACTGGGG - Intergenic
982503084 4:156184006-156184028 CACACACACATCCCTATGTGGGG - Intergenic
983918290 4:173315729-173315751 AACACACAGATCTCTCTCTGAGG + Intronic
983995411 4:174175952-174175974 CACACACCGGGCCCTGCATGGGG - Intergenic
984074128 4:175153705-175153727 AGCTCACTGATCCCTGCCTGGGG + Intergenic
984336112 4:178393542-178393564 CACACACAGGGGCCTGCCAGGGG - Intergenic
984593451 4:181641343-181641365 CACACACCGGGCCCTGCCGGGGG - Intergenic
984921129 4:184765387-184765409 CACACACATTCCCCTGCCTAGGG + Intronic
985752994 5:1693166-1693188 CAAATACACATCCCTGCATGAGG + Intergenic
985794677 5:1953189-1953211 CACACACAGCACCCAACCTGGGG + Intergenic
985987322 5:3527107-3527129 CACACACACAGCCCTGACAGTGG + Intergenic
986236727 5:5917495-5917517 CAAACACACAGCCCTCCCTGGGG - Intergenic
987135421 5:14895439-14895461 CACACACCAATCCCTTTCTGGGG - Intergenic
989359070 5:40578879-40578901 CACACACAGAGGCCTGTCAGGGG + Intergenic
991204550 5:64035560-64035582 CACACACACCTCCTTCCCTGTGG + Intergenic
991533069 5:67636981-67637003 AACACACAGATATCTGCCTTTGG + Intergenic
991625207 5:68594057-68594079 CACAGACAGGTACCTGTCTGTGG - Intergenic
992102262 5:73419250-73419272 CATAAACAGCTCCCTGCCAGCGG + Intergenic
992781902 5:80135423-80135445 CACCCACAGAGCCATCCCTGTGG - Intronic
993001509 5:82385863-82385885 GTCACACAAAGCCCTGCCTGTGG - Intronic
993458661 5:88156377-88156399 CACACACACATCCCTACCTTCGG - Intergenic
993777027 5:92012362-92012384 CACACACAGAATCCTCACTGGGG + Intergenic
994348264 5:98714349-98714371 CACACACTGAGGCCTACCTGAGG - Intergenic
995359031 5:111272079-111272101 CACACACAGAGGGCTGTCTGTGG - Intronic
995486044 5:112641041-112641063 CAGACAGAGTTCCCTGCCTGGGG + Intergenic
995730268 5:115232001-115232023 CACACACAGATAGCAGACTGTGG + Intronic
996157125 5:120115548-120115570 CACCCACAGAGCTCTCCCTGGGG + Intergenic
997378876 5:133421114-133421136 CACACCCAGGCCCCTGCCAGGGG - Intronic
999192409 5:149758073-149758095 CCCACACAGAGCGCTGTCTGTGG + Intronic
999322277 5:150622995-150623017 CAGACACACATCCATGCATGGGG + Intronic
1000447750 5:161345025-161345047 CACACACAGGGCCCTGTCTGGGG + Intronic
1003882336 6:10490073-10490095 CACAGACTGGTACCTGCCTGTGG - Intergenic
1004643871 6:17541003-17541025 CATACAAAAATCCCAGCCTGCGG + Exonic
1005011326 6:21338332-21338354 CAAACACAGATTCTTCCCTGGGG - Intergenic
1005861864 6:29908136-29908158 CAGATACAGATCCCTGGCTCAGG + Intergenic
1006476827 6:34260985-34261007 CCCACACAGAGTCCTTCCTGGGG - Intergenic
1006517518 6:34553133-34553155 CACACTAAGGTCCCTGGCTGGGG + Intronic
1007664522 6:43506426-43506448 CTCACACAGAGCCCAGCTTGAGG - Exonic
1009173731 6:60433067-60433089 CACACACAGTTCCATTTCTGTGG - Intergenic
1012349421 6:98232617-98232639 CACACACATATTCCTCACTGAGG - Intergenic
1012464249 6:99500041-99500063 CATAAACAGATTACTGCCTGGGG + Intronic
1012950214 6:105510168-105510190 CACACACTGACCCCTAACTGTGG - Intergenic
1013294914 6:108750430-108750452 CACACACACATGCTTGCTTGTGG - Intergenic
1013378469 6:109542296-109542318 CACACACCCTTCCCTGCCTGTGG - Intronic
1014613089 6:123568398-123568420 CCCACACAGATTCCTCACTGGGG - Intronic
1014857212 6:126416889-126416911 CACACACAGAGTCCTTACTGGGG + Intergenic
1016251108 6:142043835-142043857 CACAAATAGACCCTTGCCTGTGG - Intergenic
1016486950 6:144551607-144551629 CAAACAAAGATCCTTGCTTGGGG + Intronic
1017630106 6:156388799-156388821 CACAGTCAGATGCCTTCCTGGGG - Intergenic
1017926866 6:158918087-158918109 CACACACACACCCCTTCCTGAGG - Intergenic
1018647330 6:165960785-165960807 CCCACCCCGCTCCCTGCCTGAGG - Intronic
1018812232 6:167306609-167306631 CCCACACCCAGCCCTGCCTGGGG - Intronic
1019763150 7:2829199-2829221 CACAAACAGGTCCCTGCCCCAGG + Intronic
1019935000 7:4249077-4249099 CACACTCACCTCCCTCCCTGAGG - Intronic
1019988926 7:4679003-4679025 CACACAGAGTTCCCTGGCAGGGG + Intergenic
1020095106 7:5363893-5363915 AACACACAGGTCCCTCCCTCGGG + Intronic
1021832558 7:24630311-24630333 CACACACCGATCCCTGTCGGGGG + Intronic
1024056824 7:45664940-45664962 CACACACAGAGGCCTGTCAGCGG - Intronic
1024124871 7:46283374-46283396 CACACACACATCCTTGGCTTTGG - Intergenic
1024871374 7:53965668-53965690 CACACACACACACATGCCTGTGG - Intergenic
1024973885 7:55095490-55095512 AACACACAGCTCCCTGCCCAGGG + Intronic
1026561994 7:71458076-71458098 CTCACACAGATCTCTGCTTGTGG - Intronic
1028875170 7:95814085-95814107 CTCACATAAATTCCTGCCTGTGG - Intronic
1031132577 7:117849638-117849660 CACACACAGATCCCGTGCTCTGG + Intronic
1031979070 7:128112702-128112724 GACACACAGCAACCTGCCTGGGG + Intergenic
1032013240 7:128360242-128360264 CCAGCACAAATCCCTGCCTGGGG + Intronic
1032188508 7:129748511-129748533 CAGACAGAGAGACCTGCCTGAGG + Intronic
1033345971 7:140526009-140526031 CACACATGCATCCCAGCCTGCGG - Intronic
1033732728 7:144195358-144195380 CACACCCCGAGCCCTGCCTGCGG + Intronic
1033743579 7:144293938-144293960 CACACCCCGAGCCCTGCCTGCGG + Intergenic
1033750323 7:144355659-144355681 CACACCCCGAGCCCTGCCTGCGG - Intronic
1033777575 7:144629589-144629611 CACACACAGAGTTCTGACTGGGG + Intronic
1034162888 7:149005771-149005793 CACTCAGAAATCCCAGCCTGGGG - Intronic
1034317598 7:150147976-150147998 CACACACTGAAGCCTGCCAGAGG + Intergenic
1034389831 7:150777320-150777342 CACTCAGAGATGCCTGCCAGTGG + Intergenic
1034474453 7:151274566-151274588 CACAAGCGGAACCCTGCCTGGGG + Intronic
1034775159 7:153819249-153819271 CACACACTGAAGCCTGCCAGAGG - Intergenic
1034902240 7:154914797-154914819 CACACCCAGATCTCGGGCTGTGG - Intergenic
1034987580 7:155526456-155526478 CGCACACAGATCACAGCCAGAGG + Intronic
1035072592 7:156156323-156156345 CACACACATATCACAGCCAGGGG - Intergenic
1035081538 7:156220297-156220319 CACACACAGCACACAGCCTGCGG - Intergenic
1035560868 8:602600-602622 CACACCCAGGCCCCTCCCTGAGG + Intergenic
1035569966 8:666444-666466 CAGAAACAGATGCCCGCCTGGGG + Intronic
1037003330 8:13747539-13747561 CCCACACAGATCGCCTCCTGGGG - Intergenic
1037558031 8:20044776-20044798 CCCACACAGATCCATGGTTGGGG + Intergenic
1037627652 8:20622145-20622167 CACACACACATACCTGCCCTAGG + Intergenic
1037740213 8:21602817-21602839 CACATATACCTCCCTGCCTGAGG + Intergenic
1039333597 8:36566028-36566050 CAGACAAAGATCCCTACGTGAGG - Intergenic
1040085797 8:43339464-43339486 CACACACTGGGGCCTGCCTGGGG + Intergenic
1042421854 8:68600918-68600940 CACACACACTTCCCAGCCTCTGG + Intronic
1043749850 8:83921817-83921839 CACACACAGAGTCCTTACTGGGG - Intergenic
1044074314 8:87799207-87799229 CACACACAGGGCCCTGTCGGGGG + Intergenic
1044992977 8:97812835-97812857 CCCAAACAAATCACTGCCTGTGG + Intronic
1045884117 8:107076073-107076095 CACAGACATATCCTTGCCTGGGG - Intergenic
1046444835 8:114304618-114304640 CAGACACAGAGGCCTGCTTGAGG + Intergenic
1046461303 8:114540793-114540815 CACACACACATGCCAGCCTTAGG - Intergenic
1047935009 8:129767693-129767715 CAAACACGGAGCCCAGCCTGTGG + Intronic
1048071135 8:131022282-131022304 CACACACTGGGGCCTGCCTGGGG - Intronic
1048982683 8:139711439-139711461 CACAGCCAGCTCCCTCCCTGTGG + Intergenic
1049428204 8:142546886-142546908 CACACACTGAGCCCTGCCCCTGG - Intergenic
1049479529 8:142814766-142814788 CACACATTGATCTCTGACTGTGG + Intergenic
1050630072 9:7549477-7549499 CTAACACAGCTCCCTGGCTGGGG + Intergenic
1051566678 9:18507717-18507739 CACACACAAATACATGCGTGGGG - Intronic
1051990360 9:23145388-23145410 CCCACACAGAGTCCTGACTGGGG - Intergenic
1052321906 9:27176666-27176688 CACACACAGATAACTGTGTGAGG - Intronic
1053704439 9:40736212-40736234 CACACACAGAGGCCTGTCAGGGG - Intergenic
1054414524 9:64859822-64859844 CACACACAGAGGCCTGTCAGGGG - Intergenic
1057334231 9:94143264-94143286 CACACACAGAGGCCTGACAGAGG + Intergenic
1057729684 9:97597749-97597771 CACACACAGATCCGGCCCAGTGG + Intronic
1058058807 9:100474115-100474137 CACACACAGATCCCTGCCTGGGG - Intronic
1058330109 9:103750078-103750100 CTAACATAGATCCCTGCCTTAGG + Intergenic
1058548433 9:106086450-106086472 CACACACTGAGGCCTGTCTGGGG - Intergenic
1058608257 9:106746725-106746747 CACACACACACCCCTGGCTGCGG - Intergenic
1058800090 9:108537398-108537420 CAAACAAAGATCCCTGACTTTGG - Intergenic
1059710775 9:116865732-116865754 CACACACAGATCCCCTCTTCAGG - Intronic
1060147140 9:121262769-121262791 GACAAACACATTCCTGCCTGGGG + Intronic
1060874597 9:127073240-127073262 CACACACACTTCCCAGCCTCTGG + Intronic
1062383581 9:136299296-136299318 CACACCCAAATGCCTGCCTGTGG + Intronic
1203472341 Un_GL000220v1:121226-121248 CACACACACATACCTACCTACGG - Intergenic
1186394675 X:9195745-9195767 AACACACAGATGACTGCGTGGGG - Intergenic
1187218283 X:17298399-17298421 CACACACAGGGGCCTGTCTGGGG + Intergenic
1187461541 X:19491581-19491603 CACCCACATATCACTTCCTGGGG + Intronic
1188887800 X:35571852-35571874 CACACACAGATAACTGTATGTGG - Intergenic
1189377200 X:40475211-40475233 CAAACACAGAGCCCTCCGTGAGG - Intergenic
1189711528 X:43817720-43817742 CATAAACTTATCCCTGCCTGAGG + Intronic
1190132092 X:47757595-47757617 CACACACAGATCCTGGCTTTTGG + Intergenic
1191651655 X:63544913-63544935 CACACACTGAGGCCTGCCAGAGG + Intergenic
1192537573 X:71941360-71941382 CAGACATAGATCCCTGACTCAGG - Intergenic
1193558809 X:82991768-82991790 CAGACACTGGGCCCTGCCTGAGG - Intergenic
1194447175 X:94002519-94002541 CACACACAAATCCCTGCTGTAGG + Intergenic
1195166313 X:102223980-102224002 CAAACACACATCCCTACCTCTGG - Exonic
1195192547 X:102463108-102463130 CAAACACACATCCCTACCTCTGG + Exonic
1196765581 X:119238897-119238919 CAGACACAAATCTCTGCCTATGG + Intronic
1197135018 X:123050834-123050856 CACACACTGATGCCTGTCGGGGG - Intergenic
1197430702 X:126359414-126359436 CACACACCGGGCCCTGTCTGGGG + Intergenic
1198542036 X:137650166-137650188 CACACCCAGACCCCAGCCTGTGG - Intergenic
1198886988 X:141350191-141350213 CACACACTGATGCCTGTCAGAGG + Intergenic
1200249064 X:154542543-154542565 CACACCCAGCTTCCTTCCTGGGG - Intronic
1200687837 Y:6273217-6273239 TCCACACAGATGCCTACCTGAGG - Intergenic
1201047432 Y:9901485-9901507 TCCACACAGATGCCTACCTGAGG + Intergenic
1201402768 Y:13620950-13620972 CCCACACAGATTCCTCACTGTGG - Intergenic