ID: 1058058808

View in Genome Browser
Species Human (GRCh38)
Location 9:100474116-100474138
Sequence ACACACACAGATCCCTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 411}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058058808_1058058814 0 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058814 9:100474139-100474161 GTGTGCAGAGTGCGGTGGGTGGG No data
1058058808_1058058825 29 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058825 9:100474168-100474190 CGAGGGGGCTGGGCGGGGTGAGG No data
1058058808_1058058816 11 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058816 9:100474150-100474172 GCGGTGGGTGGGAGACGGCGAGG No data
1058058808_1058058822 22 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058822 9:100474161-100474183 GAGACGGCGAGGGGGCTGGGCGG No data
1058058808_1058058817 12 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058817 9:100474151-100474173 CGGTGGGTGGGAGACGGCGAGGG No data
1058058808_1058058812 -4 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058812 9:100474135-100474157 GTGTGTGTGCAGAGTGCGGTGGG No data
1058058808_1058058818 13 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058818 9:100474152-100474174 GGTGGGTGGGAGACGGCGAGGGG No data
1058058808_1058058824 24 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058824 9:100474163-100474185 GACGGCGAGGGGGCTGGGCGGGG No data
1058058808_1058058810 -8 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058810 9:100474131-100474153 GTGTGTGTGTGTGCAGAGTGCGG No data
1058058808_1058058815 6 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058815 9:100474145-100474167 AGAGTGCGGTGGGTGGGAGACGG No data
1058058808_1058058811 -5 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058811 9:100474134-100474156 TGTGTGTGTGCAGAGTGCGGTGG No data
1058058808_1058058819 14 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058819 9:100474153-100474175 GTGGGTGGGAGACGGCGAGGGGG No data
1058058808_1058058821 19 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058821 9:100474158-100474180 TGGGAGACGGCGAGGGGGCTGGG No data
1058058808_1058058826 30 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058826 9:100474169-100474191 GAGGGGGCTGGGCGGGGTGAGGG No data
1058058808_1058058813 -1 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058813 9:100474138-100474160 TGTGTGCAGAGTGCGGTGGGTGG No data
1058058808_1058058820 18 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058820 9:100474157-100474179 GTGGGAGACGGCGAGGGGGCTGG No data
1058058808_1058058823 23 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058823 9:100474162-100474184 AGACGGCGAGGGGGCTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058058808 Original CRISPR ACACACACAGATCCCTGCCT GGG (reversed) Intronic
900593716 1:3471109-3471131 ACGCACACACACCCCTGCCCAGG - Intronic
901105368 1:6751727-6751749 ACACACACAGAGCCCAGGCCTGG - Intergenic
901151062 1:7102062-7102084 ACACACACAGCTTCCTGTATTGG + Intronic
901151271 1:7104384-7104406 ACACACACAGCTTCCTGTGTTGG + Intronic
901439794 1:9270898-9270920 AAACTTACAGATGCCTGCCTGGG + Exonic
902373677 1:16020106-16020128 ACAAACACAGACCCTTTCCTTGG + Intronic
902787670 1:18743595-18743617 ACAGCCACAGATCCCAGCTTGGG + Intronic
902817290 1:18923513-18923535 ACACACCCGGCTCACTGCCTTGG + Intronic
902922046 1:19671965-19671987 ACACACACACTCCCCTGCCCTGG - Intronic
903228134 1:21905367-21905389 ACACACCAAGCCCCCTGCCTGGG + Intronic
903488243 1:23707537-23707559 AAAGACAAAGATCCCTGCCTTGG + Intergenic
904274562 1:29371920-29371942 GCACACATGGATGCCTGCCTAGG + Intergenic
904567993 1:31439487-31439509 ACACACACACATCCCTCACCAGG - Intergenic
905277045 1:36825107-36825129 ACATACACACATCCCTGTCTGGG - Intronic
906651129 1:47513604-47513626 ACCCAAACACCTCCCTGCCTAGG - Intergenic
906824166 1:48961070-48961092 ACACACACACACCCCAGACTGGG - Intronic
906914802 1:49996728-49996750 TCACAAAAAGATCACTGCCTAGG + Intronic
907712561 1:56897870-56897892 AGACACACAGAGCCCTTCCCTGG + Intronic
910459972 1:87438285-87438307 TCTCACACAGATCCCTTCCCAGG - Intergenic
910505443 1:87945499-87945521 ACACACACAGAGCCTTGACCTGG - Intergenic
910697940 1:90041557-90041579 ACAAACACTGATTCCTGGCTGGG + Intergenic
910868974 1:91814241-91814263 ACACACACACATACATGCCAAGG + Intronic
910966433 1:92812557-92812579 ACACACAAAAATCCTTGCCTAGG - Intergenic
911094544 1:94044831-94044853 ACTCTCACAGATTCCTGCCTGGG + Intronic
912152270 1:106874917-106874939 ACATACAAAGATCCCTGTTTTGG + Intergenic
912637012 1:111305508-111305530 ACATGCACAGCTGCCTGCCTTGG + Intronic
914317193 1:146524550-146524572 TCTCACACAGATCCCTTCCCAGG - Intergenic
914497162 1:148208810-148208832 TCTCACACAGATCCCTTCCCAGG + Intergenic
914973154 1:152329935-152329957 ACACACACACACCTCTGCCACGG - Intergenic
917196698 1:172473859-172473881 AGCCACACAGTTCCATGCCTTGG - Intergenic
917489285 1:175483896-175483918 ACACACACACATGACTGTCTTGG + Intronic
917495631 1:175537810-175537832 GCTCACACAGATGCCTGGCTTGG - Intronic
917611338 1:176692048-176692070 ACACAAATTTATCCCTGCCTTGG + Intronic
917931039 1:179823011-179823033 ACAAAAAAAGATTCCTGCCTGGG - Intergenic
918187180 1:182138274-182138296 ACACACAGAGATCAGAGCCTGGG - Intergenic
918707899 1:187691206-187691228 ACACACACACACCCCTGCACAGG + Intergenic
918711023 1:187730115-187730137 ACACACACAGAGGCCTGTCACGG + Intergenic
919056710 1:192580392-192580414 ACACACACATATCCCTGTTTTGG + Intergenic
920431081 1:205919545-205919567 ACACACCCAGCTCCCTGCACTGG - Intronic
921325958 1:213986498-213986520 ACACACACACACTCCTTCCTAGG - Intronic
922011639 1:221594658-221594680 ACCCAAACAGACCACTGCCTGGG - Intergenic
922469416 1:225866718-225866740 GCACCCCCAGCTCCCTGCCTGGG - Intronic
922796366 1:228341674-228341696 AGCCGCACAGGTCCCTGCCTGGG + Intronic
922935573 1:229419845-229419867 ACACAGACACTTCCCTGGCTGGG + Intergenic
924180387 1:241434705-241434727 CCACACAGGGATGCCTGCCTTGG + Intergenic
924204841 1:241701298-241701320 ACACACACAGAGCCATTCTTTGG + Intronic
924621220 1:245662765-245662787 ACACACACACATGCATGCCCTGG + Intronic
924709965 1:246523532-246523554 ACACACACAGTTCCCTGTCTGGG - Intergenic
924874502 1:248087044-248087066 ACACACACAGATCACTGTTCTGG + Intronic
1062794831 10:336821-336843 ACACACACACACAGCTGCCTAGG - Intronic
1062794840 10:336887-336909 ACACACACACACACCTGCCTAGG - Intronic
1062794848 10:336969-336991 ACACACACACACAGCTGCCTAGG - Intronic
1062794852 10:337002-337024 ACACACACACACAGCTGCCTAGG - Intronic
1062794864 10:337121-337143 ACACACACACACAGCTGCCTAGG - Intronic
1062794873 10:337189-337211 GCACACACAGACAGCTGCCTAGG - Intronic
1062794888 10:337292-337314 ACACACACACACAGCTGCCTAGG - Intronic
1063079896 10:2756865-2756887 ACACACACAGAGTCATCCCTTGG + Intergenic
1064658608 10:17582493-17582515 ACACACACACACCCCTTCTTAGG - Intergenic
1067700961 10:48571697-48571719 ACATCCACTGATCCCTGCCACGG - Intronic
1067852204 10:49761334-49761356 CCACACACACAACCCTGTCTGGG + Intronic
1068380705 10:56250485-56250507 ACACACACTGAGGCCTGTCTGGG - Intergenic
1070323008 10:75368688-75368710 GCTCACAGAGATCCCTGCATTGG + Intergenic
1070581843 10:77726317-77726339 ACACACACATATCACTTTCTTGG - Intergenic
1070636393 10:78131700-78131722 ACACACACACATCCCTTCCAGGG + Intergenic
1071878206 10:89865624-89865646 ACACAGATAGATCTCAGCCTGGG + Intergenic
1072941260 10:99766254-99766276 ACACTCACAGGACGCTGCCTAGG + Intergenic
1074356485 10:112790252-112790274 CCACACACAGATCACTGCAGAGG - Intronic
1075896323 10:125998206-125998228 ACACACACAGAACCAGGGCTTGG + Intronic
1076776317 10:132699950-132699972 CCACACTCAGACCCCTGCCAGGG - Intronic
1076779012 10:132713792-132713814 GCTCAGACCGATCCCTGCCTCGG - Intronic
1076788124 10:132761412-132761434 AGACAGACACATCCCTGCCATGG + Intronic
1077219396 11:1408754-1408776 ACACACACACACCCCTGCACAGG - Intronic
1077219424 11:1409019-1409041 ACACACATACATCCCTGCATAGG - Intronic
1077266033 11:1650749-1650771 ACACCCAGAGGTTCCTGCCTGGG + Intergenic
1077312244 11:1894158-1894180 ACACACACACATTCCAGCCTGGG - Intergenic
1077679354 11:4224439-4224461 CCACACAGGGATGCCTGCCTTGG - Intergenic
1077688775 11:4321023-4321045 CCACACAGGGATGCCTGCCTTGG - Intergenic
1078610450 11:12814764-12814786 ACACACACAGAGCTCTGCGATGG - Intronic
1078682641 11:13492649-13492671 TCACTCACAGATCTCTTCCTGGG + Exonic
1079679600 11:23278337-23278359 ACTTACTCACATCCCTGCCTTGG - Intergenic
1080600600 11:33818185-33818207 ACACTCACAGCTCCCTTCTTTGG - Intergenic
1081067870 11:38569710-38569732 ACAAAGGCAGATCCCTCCCTAGG + Intergenic
1081367874 11:42258665-42258687 GCACACACAGAATCCTGCCAAGG - Intergenic
1081606293 11:44529162-44529184 TCACACACAGATGCCTGAGTGGG + Intergenic
1083256265 11:61497908-61497930 ACACACACACCTTCCTGCCCTGG - Intergenic
1083494159 11:63035753-63035775 TCACACACCGATCCATGCCTTGG + Intergenic
1084432812 11:69121088-69121110 CCACACACACGTACCTGCCTGGG + Intergenic
1084432818 11:69121144-69121166 CCACACACACGTACCTGCCTGGG + Intergenic
1084882351 11:72180720-72180742 ACACAGACACAGCCCTGCTTTGG - Intergenic
1084940833 11:72612313-72612335 ACACACACAGAACTCAGGCTCGG + Intronic
1087173893 11:95078415-95078437 CCACATTCAGATCCCTGCCTTGG - Intergenic
1088535017 11:110851070-110851092 ACACACACAGAGCTGTGACTTGG - Intergenic
1089139569 11:116274959-116274981 ACACACACACACCCCTGCTCTGG - Intergenic
1090933722 11:131323439-131323461 AAACACACATATAGCTGCCTGGG - Intergenic
1091999546 12:5020941-5020963 ACAGATACAAATCCCTACCTTGG - Intergenic
1092160880 12:6314924-6314946 ACACACACACAGCCCTCCCGGGG + Intronic
1093071595 12:14711162-14711184 ACAGACACAGTTCACTCCCTAGG + Intergenic
1093578493 12:20763774-20763796 CCACACAGGGATGCCTGCCTTGG + Intergenic
1098077539 12:66748963-66748985 AGACAGACAGATCACTACCTAGG + Intronic
1100752673 12:97716450-97716472 ACAGAGACACATCCCTGCCATGG - Intergenic
1101006393 12:100405181-100405203 AGGCCCACACATCCCTGCCTGGG - Intronic
1101278663 12:103227679-103227701 CCACACAGGGATGCCTGCCTTGG - Intergenic
1101414118 12:104493965-104493987 ACACACACACCACCATGCCTGGG + Intronic
1101628072 12:106465623-106465645 TCACACACCGAGGCCTGCCTGGG - Intronic
1101837028 12:108303004-108303026 AAACACTCCGATCCCTGCCTGGG + Intronic
1102163289 12:110786426-110786448 ACACACTCAGAAACCTGCCTGGG - Intergenic
1102695844 12:114798770-114798792 ACACACACACACACCTGCCCGGG - Intergenic
1102974321 12:117195555-117195577 ACACACACTCATGCCAGCCTGGG + Intergenic
1103895460 12:124270226-124270248 ACAGACAAAGATCCCTGCCCTGG + Intronic
1106149422 13:27084210-27084232 ACACACACAAATTCCTGTCTGGG + Intronic
1108127170 13:47257049-47257071 AGACACATGGATCCCTGCCAAGG + Intergenic
1108392253 13:49957872-49957894 ACACACACAGGTCCCAGTGTGGG + Intergenic
1108835494 13:54541693-54541715 ACACACACACACCCCTACCAAGG - Intergenic
1110141621 13:72137736-72137758 ACACACACACATCCCAGGCTGGG - Intergenic
1110845083 13:80184375-80184397 CCACACAGGGATGCCTGCCTTGG + Intergenic
1112087142 13:96043029-96043051 ACACAAAAAGATCATTGCCTAGG + Intronic
1112435426 13:99388545-99388567 ACACTCCCACATCCCAGCCTGGG - Intergenic
1112977070 13:105333518-105333540 ACACACACAGACACATGCTTTGG - Intergenic
1114761665 14:25322667-25322689 ACATACTCAGATACCTGCCAGGG - Intergenic
1115027172 14:28759164-28759186 TCACGCTCAGATCGCTGCCTTGG - Intergenic
1115043515 14:28960088-28960110 TCACACACCGAGCCCTGTCTGGG + Intergenic
1115198197 14:30824899-30824921 CCACACACAGGTCCATGACTTGG + Intergenic
1115780640 14:36764650-36764672 ACACACACACATCCCTTCTCTGG + Intronic
1116573239 14:46544887-46544909 CCACACAGGGATGCCTGCCTTGG + Intergenic
1117818355 14:59621518-59621540 ACACACACTGCAGCCTGCCTAGG + Intronic
1120438309 14:84505137-84505159 CCACACAGGGATGCCTGCCTTGG - Intergenic
1121782976 14:96634430-96634452 ACACACACACATGCCTGCCAGGG + Intergenic
1121796509 14:96740532-96740554 AACCACACAGTTCCCAGCCTGGG - Intergenic
1121850856 14:97219868-97219890 ACACACACAGAGCCATAGCTAGG - Intergenic
1121923848 14:97909684-97909706 ACACACACTGAGCCCTGTCAGGG - Intergenic
1122544151 14:102513047-102513069 GCACACACAGACCCCTGCCCTGG - Intergenic
1122787536 14:104170898-104170920 ACACACACAGATCTCAAACTGGG - Intronic
1122857432 14:104566593-104566615 ACAGACCCACCTCCCTGCCTTGG + Intronic
1122863364 14:104592728-104592750 CCACACACAGACCCCTGCCATGG + Intronic
1123432158 15:20227360-20227382 AAACACCCACATCCCTGCCCAGG + Intergenic
1124425926 15:29562723-29562745 ACATAGACAGAACCCTCCCTTGG - Intronic
1127256219 15:57296192-57296214 ACACACTAAGATACCTGCCTAGG + Intronic
1128283138 15:66413839-66413861 ACAGGCCCAGATCCCTGCTTTGG - Intronic
1128957734 15:71966257-71966279 ACACACACACACACTTGCCTGGG - Intronic
1129226480 15:74173458-74173480 ACACACATACAACCCTGGCTTGG + Intergenic
1129330195 15:74823225-74823247 ACACACACAGCTAGATGCCTAGG + Intronic
1130101907 15:80900575-80900597 ACACACACACACCCCTACCTGGG - Intronic
1130550510 15:84887614-84887636 GCACAGCCAGAGCCCTGCCTGGG - Intronic
1130695347 15:86125688-86125710 ATATGCAGAGATCCCTGCCTAGG - Intergenic
1130836660 15:87656470-87656492 ACACACACATGCCCATGCCTGGG - Intergenic
1130854837 15:87831960-87831982 CCACACAGGGATGCCTGCCTTGG + Intergenic
1131302810 15:91214360-91214382 ACACACAGATATGCCTTCCTAGG - Intronic
1131726365 15:95230075-95230097 ACAGACAAAGCTCCCTGCTTTGG - Intergenic
1132041210 15:98525704-98525726 CCACACACACACCCCTGCCCTGG + Intergenic
1133322673 16:4923878-4923900 ACAGACAAAGAGCCCTGCCCTGG - Intronic
1134002455 16:10793395-10793417 CCACACACAGGGCCCAGCCTGGG - Intronic
1134600286 16:15528569-15528591 ACACACACACACCACTCCCTTGG + Intronic
1135191775 16:20360311-20360333 TAACACACAGCTCCTTGCCTTGG - Intronic
1135548592 16:23381431-23381453 ACACTCACTGATCCCTGCCTGGG + Intergenic
1135633484 16:24054611-24054633 ACACACACAGCTCCCCTTCTTGG - Intronic
1136026474 16:27472041-27472063 ACACACACATACGCCAGCCTGGG - Intronic
1136528907 16:30853308-30853330 ACACACACACACACCAGCCTAGG + Intronic
1138415355 16:56868358-56868380 GCACTCACCGATGCCTGCCTGGG - Exonic
1141189484 16:81814114-81814136 TAACACACAGACCCCAGCCTGGG - Intronic
1141545560 16:84765768-84765790 ACACAGACAGACCCGTGACTGGG + Intronic
1142297345 16:89234135-89234157 ACACACACAGGTTCCTGACATGG - Exonic
1143203747 17:5129420-5129442 ACACACACAGTCCCTTGTCTGGG + Intronic
1143523663 17:7460739-7460761 ACACCCAAAGATCCCAGCCTAGG - Exonic
1143869510 17:9948292-9948314 ACCCACACAGTTCCTTTCCTTGG - Intronic
1144511198 17:15878442-15878464 ACACTCACAGGGCCCTGGCTGGG - Intergenic
1145175360 17:20696145-20696167 ACACTCACAGGGCCCTGGCTGGG - Intergenic
1145289054 17:21528621-21528643 ACACTCCTAGATCCCTGCCGCGG + Exonic
1146608880 17:34287353-34287375 TCACTCCCAGCTCCCTGCCTGGG + Intronic
1147163376 17:38580300-38580322 ACACATACACACCCCTCCCTGGG + Intronic
1147306633 17:39568728-39568750 ACACACACATGCCCCTGCATGGG + Intergenic
1147364141 17:39949488-39949510 ACACACACACGTATCTGCCTCGG + Intergenic
1147498195 17:40937479-40937501 AGACACACAGAGCCCAGCCGTGG - Intronic
1147953452 17:44119729-44119751 ACAAGCACAGATTCCTGTCTGGG + Intronic
1148500522 17:48087279-48087301 AGAAATACAGATGCCTGCCTGGG + Intronic
1151180719 17:72325614-72325636 ACACCCAAAAATCCCTGCCCAGG + Intergenic
1151420325 17:73992882-73992904 ACACACACACACCCCTCCCCAGG - Intergenic
1151792664 17:76318786-76318808 ACACACAAAGATGACTGCCGGGG + Intronic
1153020410 18:623707-623729 ACACACACACACTCCTGTCTGGG + Intronic
1154056950 18:11021992-11022014 ACAGACACAGATGTATGCCTGGG - Intronic
1154207060 18:12346367-12346389 ACACACGCATACCCCTGCCCCGG + Intronic
1155581171 18:27308359-27308381 ACACACACAGAGGCCTGTCGAGG + Intergenic
1155697269 18:28698013-28698035 CCACACAGGGATGCCTGCCTTGG - Intergenic
1156409046 18:36810467-36810489 TCCCACACAGATCCATGCCCAGG + Intronic
1157820122 18:50760977-50760999 ACACACACATACCCCTCCCTCGG - Intergenic
1158310892 18:56156917-56156939 TCACACACAGATGCCTGTCGTGG + Intergenic
1159837484 18:73356635-73356657 ACACACACCTATGCCTGTCTGGG + Intergenic
1160059215 18:75514525-75514547 ACAAACTCAGATCCCTTCCAGGG + Intergenic
1160410954 18:78675159-78675181 AAACACCGAGATACCTGCCTGGG + Intergenic
1160701797 19:511106-511128 ACACAGACGGAGCCCTGGCTGGG + Intronic
1160827544 19:1087714-1087736 ACACACACAGTCCGCGGCCTGGG + Exonic
1161318823 19:3631777-3631799 CAAAACACAGAGCCCTGCCTGGG + Exonic
1163033475 19:14558972-14558994 ACACACACACACGCCTGCCCAGG - Intronic
1163241395 19:16066024-16066046 ACACACACACTTCGCTGCCTAGG - Intergenic
1163241553 19:16067014-16067036 ACACACACTTTTCTCTGCCTAGG - Intronic
1164152749 19:22569167-22569189 CCACACAGGGATGCCTGCCTTGG + Intergenic
1165076034 19:33280503-33280525 ACACACACACACACCTGGCTTGG + Intergenic
1165158556 19:33802671-33802693 TCACTCACAGAGCCCTGTCTAGG + Intronic
1165766764 19:38356510-38356532 TCGCACACAGACCACTGCCTGGG - Exonic
1166315657 19:41988154-41988176 ACTCACACAGAACCCTCCCTGGG + Intronic
1166529084 19:43531997-43532019 ACAAACAAAAATCCCAGCCTAGG - Intronic
1166705783 19:44907262-44907284 ACCCCCACACAGCCCTGCCTGGG + Intronic
1166780841 19:45341948-45341970 CCACACACTGATCCCTGACGCGG - Intronic
1167446277 19:49539467-49539489 ACACAGACAAATCCCTTCTTGGG + Intronic
1167740071 19:51319191-51319213 ACGCACCAAGATCCCTTCCTAGG - Intronic
925320047 2:2958262-2958284 ACACACACACATCACTGTGTTGG - Intergenic
926547987 2:14265531-14265553 ACACATACAGACACCTGACTAGG - Intergenic
926633526 2:15158390-15158412 AGACACAAAGGCCCCTGCCTGGG + Intergenic
927037205 2:19190381-19190403 ACACAGACAGAGCCATGCCAGGG - Intergenic
928135379 2:28683780-28683802 GCTCACACAGGTCCTTGCCTTGG - Intergenic
928327478 2:30331075-30331097 ACACACACACATGCTTGCATGGG - Intergenic
928362588 2:30678108-30678130 GCACCCACAAATCCCTCCCTGGG + Intergenic
929010130 2:37433876-37433898 TCACAAAAAGATCACTGCCTAGG - Intergenic
929489116 2:42380808-42380830 CTACACCCAGATCCTTGCCTCGG - Intronic
929513702 2:42586606-42586628 ACACACACACATCGTTGGCTGGG + Intronic
930069517 2:47354611-47354633 ACACAAACACACCTCTGCCTGGG + Intronic
930376469 2:50573390-50573412 AAACACATGGATCTCTGCCTAGG + Intronic
930880920 2:56269324-56269346 ACACACACACACCCTTGCCAAGG - Intronic
931184444 2:59936452-59936474 ACACACACACACTCCTTCCTAGG - Intergenic
931263801 2:60642726-60642748 ACACACACACATCAATGCCTGGG + Intergenic
932017272 2:68043938-68043960 ACACACACACCAACCTGCCTTGG + Intronic
932159696 2:69448485-69448507 CCACACAGGGATGCCTGCCTTGG - Intergenic
932176568 2:69608265-69608287 ACCCACCCAGCTCCCTGCCCAGG + Intronic
932825931 2:74940011-74940033 ACACACACACATTCCTGCACAGG + Intergenic
934048809 2:88192950-88192972 ACACACACAGAGCCCTTGTTTGG - Intergenic
934561742 2:95317171-95317193 TCTCACACAGTCCCCTGCCTAGG - Intronic
934864835 2:97798415-97798437 ACACACACCGATCTATGCCAGGG - Intronic
935734263 2:106094282-106094304 ACACTCACAGAACCATGCTTTGG + Intronic
935857596 2:107292250-107292272 ACACACACAGCTCTGTGTCTGGG - Intergenic
936232327 2:110713758-110713780 ACACACACACATTCCAGCCCAGG + Intergenic
936339469 2:111618381-111618403 TCACGCTCAGATCCCTGTCTGGG - Intergenic
936883108 2:117279619-117279641 CCACACAGGGATGCCTGCCTTGG + Intergenic
936911184 2:117595710-117595732 TCACAAAAAGATCCTTGCCTAGG - Intergenic
937268108 2:120629958-120629980 CCTCACACAGAGCACTGCCTAGG - Intergenic
939577820 2:143917327-143917349 ACACACACATATACCTAGCTGGG - Intergenic
943698788 2:190966594-190966616 ACACACACACATCCATGGATAGG + Intronic
943757848 2:191575744-191575766 ACACACACACACCCCTGGATGGG + Intergenic
944019130 2:195079599-195079621 TCACACACAGAGGCCTGTCTGGG + Intergenic
944047549 2:195430179-195430201 ACATACACAGAGCCCTGCACTGG - Intergenic
944451464 2:199847694-199847716 ACACACACTGATGGATGCCTGGG - Intronic
944980472 2:205113383-205113405 ACACACACACACCCCTGCTCAGG - Intronic
945428374 2:209735936-209735958 ACACACACACATCCCAGATTTGG + Intergenic
946194621 2:218025643-218025665 ACTAAGGCAGATCCCTGCCTGGG + Intergenic
946321763 2:218958872-218958894 ACACACACAGATCTCATACTTGG - Intergenic
947101921 2:226630299-226630321 ACACAGACACATCCGTGCTTGGG - Intergenic
948390395 2:237607601-237607623 CCACACAGGGATGCCTGCCTTGG + Intergenic
948674809 2:239591080-239591102 ACACACACACAACCCTCCCATGG + Intergenic
1168771085 20:417382-417404 ACACACACAAACCCCAGTCTGGG - Intronic
1170862995 20:20126691-20126713 ACACAAAAAGATCATTGCCTAGG - Intronic
1171148176 20:22803879-22803901 ACAAACACAGAGGCCTGCCAGGG + Intergenic
1172434523 20:34919568-34919590 ACACACACACACACTTGCCTTGG - Exonic
1172448201 20:35003908-35003930 ACACGCACCCAGCCCTGCCTGGG - Intronic
1174178706 20:48661567-48661589 ACACACACTGACCCCTTTCTAGG + Intronic
1174282103 20:49446921-49446943 ACACACACAGCTCCTTCTCTAGG - Intronic
1174401314 20:50277507-50277529 ACACACAAAAATCCCCACCTGGG - Intergenic
1174810104 20:53638204-53638226 ACACACACACACACCTGCCATGG - Intergenic
1174863772 20:54116117-54116139 ACACACACAGTTCCCCTGCTTGG + Intergenic
1174975573 20:55329300-55329322 ACACACACACATTCCTTCCCTGG - Intergenic
1176408866 21:6437035-6437057 ACCCCCACAGCTCCCTGCTTGGG + Intergenic
1177405166 21:20657604-20657626 ACACACACAAATATCTGCTTTGG - Intergenic
1177410086 21:20718617-20718639 ACACAAACACATCCCAGTCTTGG + Intergenic
1179539849 21:42076992-42077014 ACACACACACACCCCTCCCCTGG - Intronic
1179543578 21:42100122-42100144 ACAGCCACAGATGCCAGCCTGGG - Intronic
1179670408 21:42942955-42942977 CCACACTCAGAACCCTGCTTAGG + Intergenic
1179684360 21:43045357-43045379 ACCCTCACAGCTCCCTGCTTGGG + Intergenic
1179724082 21:43332064-43332086 GCCCACACAAAGCCCTGCCTGGG - Intergenic
1179769438 21:43603450-43603472 AAACAGACAGAACCCTGCCAGGG + Intronic
1179836218 21:44035408-44035430 ACACACACACATCCATGTCTTGG - Intronic
1179837468 21:44046374-44046396 ACACCCACAAATCTCTGACTGGG - Intronic
1180145806 21:45918106-45918128 ACACACACAGATCCAGGCTGTGG + Intronic
1180706372 22:17812724-17812746 TCACACCCAGATTCCTACCTAGG - Intronic
1181158055 22:20937170-20937192 ACCCACACACAGACCTGCCTAGG + Intronic
1181345500 22:22217171-22217193 ACACACACACACACCTGTCTTGG - Intergenic
1181694953 22:24588401-24588423 ACACACACACTTGGCTGCCTGGG - Intronic
1182350181 22:29695089-29695111 ACACACACACACCGGTGCCTTGG - Exonic
1182620324 22:31615143-31615165 TCCCACACAGCCCCCTGCCTGGG + Exonic
1182905686 22:33934201-33934223 ACACACACCGGTGCCTGGCTGGG + Intergenic
1184198244 22:42946620-42946642 ACACACAAAGCTGCCTGCCCAGG + Intronic
1184373532 22:44097695-44097717 CCACACATAGCTGCCTGCCTGGG + Intronic
1184656027 22:45942421-45942443 ACACACACAGAGCTCAGGCTGGG + Intronic
1184744966 22:46450845-46450867 AGAGACAGAAATCCCTGCCTTGG - Intronic
949207297 3:1455252-1455274 CCAGACCCAGATCCCTGTCTAGG - Intergenic
952167733 3:30769394-30769416 ACACACCCAGATACCTCCTTAGG + Intronic
952959718 3:38581702-38581724 ACACACATTGAGCCCTGTCTTGG + Intronic
953105006 3:39869028-39869050 ACTCAAAAAGATCCATGCCTAGG - Intronic
953607031 3:44418952-44418974 ACACAAACATATCCTGGCCTGGG + Intergenic
954422438 3:50425779-50425801 ACACATACATCTCCCTCCCTGGG + Intronic
955134842 3:56206684-56206706 ACACACACACATCCCAGATTAGG + Intronic
955175481 3:56610049-56610071 ACACAAAAAGATCTCTGCCTAGG - Intronic
955253161 3:57304680-57304702 CCACACAGGGATGCCTGCCTTGG + Intronic
956235105 3:67060810-67060832 ACACACACAGAGCCCTGCGTAGG + Intergenic
957156183 3:76548342-76548364 ACACACATAGATTCCAGCCCTGG + Intronic
959783698 3:110267509-110267531 CCACACTCAGATCCCTGCAGAGG - Intergenic
960141314 3:114154312-114154334 ACACACACATCTCCCACCCTGGG - Intronic
961375127 3:126460049-126460071 ACAAACACCGAGCCTTGCCTGGG + Intronic
961893924 3:130151902-130151924 CCACACAGGGATGCCTGCCTTGG - Intergenic
962130212 3:132664772-132664794 GCACATACAGCTCCCTTCCTAGG - Intronic
962281872 3:134058252-134058274 ACACACACACAGCTCTCCCTAGG + Intergenic
962504798 3:136035700-136035722 TCACACAAAGATCACTGCCTAGG - Intronic
964907927 3:161741365-161741387 ATACACACAGATCCTTTCCAGGG + Intergenic
965105462 3:164347004-164347026 CCACGCAGAGATACCTGCCTTGG - Intergenic
965626591 3:170688368-170688390 CCACACAGGGATGCCTGCCTTGG - Intronic
966066554 3:175828350-175828372 CCACACAGGGATGCCTGCCTTGG + Intergenic
967988298 3:195112641-195112663 ACACACGCAGCTCCCAGCCCCGG + Intronic
967988309 3:195112709-195112731 ACACACGCAGCTCCCAGCCCCGG + Intronic
968736468 4:2299541-2299563 ACAAACACAGCTCCCTGTCTGGG - Intronic
968843860 4:3028520-3028542 AGACACACAGAGCCATGCCCAGG - Intronic
969570075 4:8003033-8003055 ACAGACAAAGTTCCCTGTCTGGG - Intronic
969609309 4:8218105-8218127 ACACACACACATGCCTGCCCAGG - Intronic
970986273 4:22162538-22162560 ACACACACAGACACCTCCATGGG + Intergenic
973894591 4:55398628-55398650 ACACACACATCTTGCTGCCTTGG + Intronic
974894986 4:67927523-67927545 ACCCTCACAGCTCCATGCCTGGG + Intronic
977088503 4:92636740-92636762 ACACACACAGATCCCAGGACAGG + Intronic
978031273 4:103942137-103942159 CCACACAGGGATGCCTGCCTTGG + Intergenic
978830662 4:113080353-113080375 TCACACACAAATCTCTTCCTTGG - Intronic
979139193 4:117151114-117151136 ACCCACACAGAGTCCTGACTGGG - Intergenic
979323671 4:119353658-119353680 AAACACACAAATGCCTGCCGGGG - Intergenic
980527648 4:134013036-134013058 CCACACAGGGATGCCTGCCTTGG + Intergenic
982503085 4:156184007-156184029 ACACACACACATCCCTATGTGGG - Intergenic
982970805 4:161983224-161983246 ACACAGACACACCCCTGACTTGG - Intronic
983241501 4:165238324-165238346 AAACACACAAATGCCTGCCGGGG - Intronic
984761215 4:183364483-183364505 ACGCACACAGTTCCTTTCCTTGG - Intergenic
984880278 4:184404764-184404786 GCACCTACAGATCCCTGTCTCGG - Intronic
984921128 4:184765386-184765408 ACACACACATTCCCCTGCCTAGG + Intronic
985243233 4:187953042-187953064 ACACACATATATATCTGCCTCGG + Intergenic
985435496 4:189926709-189926731 CCACACAGGGATGCCTGCCTTGG + Intergenic
985490697 5:176849-176871 ACGCACACAGGACTCTGCCTGGG + Intronic
985524805 5:396371-396393 AGACACACAGACCCCAGCCATGG - Intronic
985653741 5:1119433-1119455 GCACGCACACATCCCTGCCCGGG + Intergenic
986119284 5:4816593-4816615 GCACACTCAGACTCCTGCCTGGG - Intergenic
986193293 5:5516388-5516410 CCACACAGGGATGCCTGCCTTGG + Intergenic
989266792 5:39484051-39484073 ACACACACACTTCTCTGGCTTGG + Intergenic
990596285 5:57315446-57315468 ACACACACACACCCCTCTCTAGG + Intergenic
993629792 5:90272148-90272170 ACACACACAGTTCTTTTCCTTGG - Intergenic
993836412 5:92824589-92824611 CCACACAGGGATGCCTGCCTTGG + Intergenic
994665770 5:102703678-102703700 ACACACAGGCATTCCTGCCTGGG - Intergenic
995036622 5:107541629-107541651 ACACACACAAATCCCAGATTGGG + Intronic
995486043 5:112641040-112641062 ACAGACAGAGTTCCCTGCCTGGG + Intergenic
995743516 5:115379167-115379189 ATCTACTCAGATCCCTGCCTTGG - Intergenic
997272931 5:132556995-132557017 GCACTCACAGCTTCCTGCCTCGG - Exonic
997865307 5:137457184-137457206 ACATACACAGATACCTGCAGAGG + Intronic
998649668 5:144103922-144103944 ACCCACACAGATCCCTTCAGAGG - Intergenic
999314628 5:150575688-150575710 ACACACACACACGCCTTCCTCGG - Intergenic
999374258 5:151075936-151075958 CCACACACACACCCCTGCCTGGG + Intronic
999894533 5:156015810-156015832 ACACACACAGTGCACTGCATTGG + Intronic
1000447749 5:161345024-161345046 TCACACACAGGGCCCTGTCTGGG + Intronic
1001048050 5:168390747-168390769 ACACAGACGGGGCCCTGCCTTGG + Intronic
1001084237 5:168688810-168688832 AGACACACAGATGGCTTCCTGGG - Intronic
1002166760 5:177352314-177352336 ACAGACACAGATCCTGGCCTGGG + Intergenic
1002190473 5:177474879-177474901 ATACTCACAGGCCCCTGCCTTGG + Intergenic
1003067597 6:2917022-2917044 ACACACACACACTCCAGCCTAGG - Intergenic
1003488223 6:6597700-6597722 ACACACAGTGATGCCTTCCTGGG - Intronic
1003785745 6:9485123-9485145 ACACACACACACCCCAGACTAGG - Intergenic
1003942428 6:11043480-11043502 ACACACACAGCTTACTGCCGAGG + Intronic
1005330508 6:24745429-24745451 ACACACACAGATCTCCCTCTTGG - Intergenic
1005486693 6:26307268-26307290 ACACACAAAATTCCCTGCCCTGG + Intergenic
1007600967 6:43080967-43080989 ACACACACACAGCCCTTTCTTGG + Intronic
1007699393 6:43757939-43757961 ACACACACAGAGCCCAGGCGCGG + Intergenic
1008315110 6:50030350-50030372 GCACACAAAGGTCCCTGGCTTGG - Intergenic
1012306781 6:97668891-97668913 ACCCACTTAGATCCCTTCCTGGG + Intergenic
1012547474 6:100436012-100436034 ACACACACACACCCCTCCCAAGG + Intronic
1013002576 6:106038724-106038746 ACATACACAGCTGCCTGCCATGG + Intergenic
1013189370 6:107789301-107789323 ACCCAGAAAGATCCCTTCCTTGG + Intronic
1014613091 6:123568399-123568421 ACCCACACAGATTCCTCACTGGG - Intronic
1015022338 6:128491754-128491776 ACGCACACAGAACCCTGGCCAGG - Intronic
1016518562 6:144924022-144924044 CCACACAGGGATGCCTGCCTTGG + Intergenic
1016535990 6:145108032-145108054 CCACACAGGGATGCCTGCCTTGG - Intergenic
1016853018 6:148640584-148640606 TCACACAGGGATGCCTGCCTTGG + Intergenic
1018848011 6:167568534-167568556 ACACACACAGAACCCCACCAAGG + Intergenic
1019116605 6:169769265-169769287 TCACACTCAGTTCCCTTCCTTGG + Intronic
1019151084 6:170006318-170006340 CAGCACACAGAGCCCTGCCTGGG + Intergenic
1019361762 7:608652-608674 CCACACACTGATCCCTCCCCAGG - Intronic
1019442032 7:1052381-1052403 CCACACACAGGTCCCTCCCCAGG - Intronic
1019721849 7:2577121-2577143 CCACACACAGAGCCCTGAGTGGG + Intronic
1019785069 7:2971581-2971603 AGACACACAGACCCCTCCTTGGG - Intronic
1020095105 7:5363892-5363914 CAACACACAGGTCCCTCCCTCGG + Intronic
1020287167 7:6692895-6692917 ACACACACACATCCCCCTCTAGG + Intronic
1020541352 7:9463327-9463349 CCACACAGGGATGCCTGCCTTGG - Intergenic
1021832557 7:24630310-24630332 TCACACACCGATCCCTGTCGGGG + Intronic
1022033419 7:26512980-26513002 GCACACAGAGGGCCCTGCCTGGG - Intergenic
1022151009 7:27606337-27606359 ATAAACACAGATCCCTTCCTGGG + Intronic
1022186331 7:27973273-27973295 ACACACACACACTCCAGCCTGGG - Intronic
1022251293 7:28610963-28610985 ACACACACACCCCCCTACCTTGG - Intronic
1023090581 7:36614319-36614341 ACACACATAAAGCCCTGCCCGGG - Intronic
1024973884 7:55095489-55095511 CAACACACAGCTCCCTGCCCAGG + Intronic
1026678504 7:72447936-72447958 ACACACACAGACGCCTGCCTAGG + Intergenic
1026678510 7:72447992-72448014 ACACACACACATGCCTGCCCAGG + Intergenic
1028171970 7:87609019-87609041 ACATACAAAAATCCCTGCCTAGG + Intronic
1030533603 7:110738736-110738758 TCACAAAAAGATCCTTGCCTAGG + Intronic
1031250028 7:119368155-119368177 ACACTCACAGTTACCTTCCTTGG + Intergenic
1031979069 7:128112701-128112723 AGACACACAGCAACCTGCCTGGG + Intergenic
1032457911 7:132087560-132087582 GCACACACAGATCCAGGCCAGGG + Intergenic
1032787064 7:135209477-135209499 TCACATACAGATTCCTCCCTAGG + Intronic
1033600809 7:142887188-142887210 ACACACACACTCCCCTGGCTGGG - Intergenic
1034417825 7:150974569-150974591 ACCCCCACAGAACCCTGCCCGGG + Intronic
1034519993 7:151612469-151612491 CCAAGCACAGAGCCCTGCCTAGG + Intronic
1034622822 7:152469522-152469544 CCAAACACAGATCCCTGCAGTGG - Intergenic
1034991474 7:155550411-155550433 ACAGACCCAGGTCCCAGCCTGGG + Intergenic
1035592032 8:823628-823650 ACACCCACACATCCCTGCTGGGG - Intergenic
1036033442 8:4994975-4994997 AGACAGACAGAGCCCAGCCTCGG + Intergenic
1040794930 8:51279193-51279215 ACAGACACAGCTGCCTCCCTAGG + Intergenic
1041175713 8:55194011-55194033 AACCACAGAGCTCCCTGCCTGGG + Intronic
1041728245 8:61038373-61038395 ACTCAGACAGAGCCCTTCCTTGG + Intergenic
1042847105 8:73179287-73179309 ACACACACACACCCCTACCTGGG - Intergenic
1043495350 8:80794712-80794734 ACACACACAAAGCTGTGCCTGGG + Intronic
1044800371 8:95947848-95947870 AAACACAGAGATCACTGTCTTGG - Intergenic
1045036396 8:98179701-98179723 ACACACACAGATCAATGACATGG - Intergenic
1045884118 8:107076074-107076096 ACACAGACATATCCTTGCCTGGG - Intergenic
1046701408 8:117405018-117405040 AGACACACAGATGCCTTCCATGG + Intergenic
1046714530 8:117553067-117553089 ACACACACACACCCATCCCTGGG + Intergenic
1046772043 8:118126051-118126073 ACAAACACATATCCTTGGCTGGG + Intergenic
1047568169 8:126069082-126069104 ACACACACAGTCCACTGCCAAGG - Intergenic
1047798122 8:128278650-128278672 ACACACTTAGATCACAGCCTAGG + Intergenic
1049587617 8:143439273-143439295 GCACACTCAAATGCCTGCCTCGG - Intronic
1049597390 8:143491116-143491138 ACACACACATATCCACGGCTGGG + Intronic
1051566679 9:18507718-18507740 ACACACACAAATACATGCGTGGG - Intronic
1052488865 9:29137360-29137382 TCATACACATCTCCCTGCCTGGG + Intergenic
1052527184 9:29632932-29632954 GCAATCACAGATACCTGCCTTGG - Intergenic
1056021049 9:82438717-82438739 ACACACACAGGTCATTGCTTAGG - Intergenic
1056270573 9:84944639-84944661 GCACACACAGATCCAGCCCTTGG - Intronic
1057335443 9:94151515-94151537 ACACACACACATTCGTCCCTGGG - Intergenic
1058058808 9:100474116-100474138 ACACACACAGATCCCTGCCTGGG - Intronic
1058610571 9:106771337-106771359 ACACACACACATCTTAGCCTGGG - Intergenic
1059093038 9:111382035-111382057 ACACACAAAGAATCCTTCCTAGG + Intronic
1060754510 9:126203087-126203109 ACTCCCACAGATCCCTGCCGTGG + Intergenic
1061133494 9:128721028-128721050 AGTCAGACAGATCCCTGCCTTGG - Exonic
1061821470 9:133229212-133229234 ACACACACACACACCTGTCTTGG - Intergenic
1061833968 9:133317151-133317173 ACACACACACACACCTGTCTTGG + Intergenic
1061922543 9:133789940-133789962 ACACGAACAGGGCCCTGCCTGGG + Intronic
1062237776 9:135520852-135520874 ACACACACACACACCTGTCTTGG + Intergenic
1062385606 9:136310322-136310344 ACACACACACACGCCTGCCCGGG + Intergenic
1062672921 9:137722534-137722556 CCACACACACAGCCCTGCCCTGG - Intronic
1185883482 X:3760940-3760962 ACACAGGCAAAGCCCTGCCTAGG - Intergenic
1187394428 X:18907274-18907296 ACAGACACCCATCCCTGTCTGGG - Intronic
1188312626 X:28636462-28636484 AAAGACACAGTTGCCTGCCTTGG - Intronic
1189132949 X:38519111-38519133 ACACACACACAGCCATTCCTGGG - Intronic
1190476012 X:50828107-50828129 CCACAAACTGACCCCTGCCTGGG + Intergenic
1190801205 X:53790729-53790751 ACACACACACATACTTGCATGGG + Intergenic
1191854054 X:65608413-65608435 ACATACACATATTCCTGCATGGG - Intronic
1192810443 X:74542554-74542576 TGACACACAGATCCCCACCTAGG + Intergenic
1193575081 X:83186220-83186242 ACACATGCACATACCTGCCTGGG + Intergenic
1193941214 X:87682544-87682566 CCACACAGGGATGCCTGCCTTGG + Intergenic
1194037314 X:88892157-88892179 ACACACACACACACATGCCTGGG + Intergenic
1194308781 X:92277928-92277950 AGACACAGGGATGCCTGCCTTGG - Intronic
1194354473 X:92864828-92864850 ACACACCCAGATCCTGTCCTAGG - Intergenic
1194730482 X:97447583-97447605 ACCCACACAGCCCCCTGCTTTGG - Intronic
1194950611 X:100121551-100121573 ACACACACAAATCAGTCCCTGGG - Intergenic
1196774095 X:119322604-119322626 CCACACAGGGATGCCTGCCTTGG - Intergenic
1197470719 X:126863926-126863948 CCACACAGGGATGCCTGCCTTGG + Intergenic
1197668927 X:129254699-129254721 TCGCAAACAGATCACTGCCTAGG - Intergenic
1199835655 X:151587528-151587550 ACATACACACATACCTGCATAGG - Intronic
1199992010 X:152992828-152992850 CCACACACATGTCCCTGCCCAGG + Intronic
1200249065 X:154542544-154542566 ACACACCCAGCTTCCTTCCTGGG - Intronic
1200662834 Y:5981856-5981878 ACACACCCAGATCCTGTCCTAGG - Intergenic
1200782015 Y:7225262-7225284 ACACAGGCAAAGCCCTGCCTAGG + Intergenic
1200794169 Y:7325696-7325718 ACACACTCAGGGCCCTGCCAGGG - Intergenic
1200969614 Y:9136831-9136853 ACACACACACACCCCTCCATAGG + Intergenic
1201936840 Y:19419318-19419340 ACACACAGGGATGCCTGCCTTGG + Intergenic
1202141385 Y:21727413-21727435 ACACACACACACCCCTCCATAGG - Intergenic
1202145480 Y:21776389-21776411 ACACACACACACCCCTCCATAGG + Intergenic