ID: 1058058809

View in Genome Browser
Species Human (GRCh38)
Location 9:100474117-100474139
Sequence CACACACACAGATCCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 630
Summary {0: 1, 1: 0, 2: 7, 3: 76, 4: 546}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058058809_1058058817 11 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058817 9:100474151-100474173 CGGTGGGTGGGAGACGGCGAGGG No data
1058058809_1058058819 13 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058819 9:100474153-100474175 GTGGGTGGGAGACGGCGAGGGGG No data
1058058809_1058058824 23 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058824 9:100474163-100474185 GACGGCGAGGGGGCTGGGCGGGG No data
1058058809_1058058818 12 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058818 9:100474152-100474174 GGTGGGTGGGAGACGGCGAGGGG No data
1058058809_1058058821 18 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058821 9:100474158-100474180 TGGGAGACGGCGAGGGGGCTGGG No data
1058058809_1058058816 10 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058816 9:100474150-100474172 GCGGTGGGTGGGAGACGGCGAGG No data
1058058809_1058058815 5 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058815 9:100474145-100474167 AGAGTGCGGTGGGTGGGAGACGG No data
1058058809_1058058823 22 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058823 9:100474162-100474184 AGACGGCGAGGGGGCTGGGCGGG No data
1058058809_1058058812 -5 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058812 9:100474135-100474157 GTGTGTGTGCAGAGTGCGGTGGG No data
1058058809_1058058811 -6 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058811 9:100474134-100474156 TGTGTGTGTGCAGAGTGCGGTGG No data
1058058809_1058058822 21 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058822 9:100474161-100474183 GAGACGGCGAGGGGGCTGGGCGG No data
1058058809_1058058810 -9 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058810 9:100474131-100474153 GTGTGTGTGTGTGCAGAGTGCGG No data
1058058809_1058058825 28 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058825 9:100474168-100474190 CGAGGGGGCTGGGCGGGGTGAGG No data
1058058809_1058058813 -2 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058813 9:100474138-100474160 TGTGTGCAGAGTGCGGTGGGTGG No data
1058058809_1058058820 17 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058820 9:100474157-100474179 GTGGGAGACGGCGAGGGGGCTGG No data
1058058809_1058058814 -1 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058814 9:100474139-100474161 GTGTGCAGAGTGCGGTGGGTGGG No data
1058058809_1058058826 29 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058826 9:100474169-100474191 GAGGGGGCTGGGCGGGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058058809 Original CRISPR CACACACACAGATCCCTGCC TGG (reversed) Intronic
900303385 1:1989285-1989307 CACACACACAGCTGCGTGGCCGG - Intronic
900383847 1:2400175-2400197 CCCACACGCAGCTCCCTGCCAGG + Intronic
900561667 1:3310118-3310140 CACATACACACATCCCTGTCAGG + Intronic
901656743 1:10773731-10773753 CACACACACAGACTGCTGTCTGG - Intronic
902354062 1:15883233-15883255 CACACACACAGTTCCTGGGCGGG + Intronic
902787669 1:18743594-18743616 CACAGCCACAGATCCCAGCTTGG + Intronic
903219001 1:21858535-21858557 CACATACCCAAATGCCTGCCTGG + Intronic
904210615 1:28884747-28884769 CACACACACAGGTGCCTGGGTGG + Intergenic
904297164 1:29527480-29527502 CACCCACTCAGATCTGTGCCAGG - Intergenic
904591959 1:31619907-31619929 CACTCACAGAGATCCCCTCCTGG + Intronic
904946973 1:34206477-34206499 CATACACAAAGATCTCTGCTGGG - Intronic
905233667 1:36530707-36530729 CACACACACACACCCTTCCCTGG - Intergenic
905277046 1:36825108-36825130 CACATACACACATCCCTGTCTGG - Intronic
906824167 1:48961071-48961093 CACACACACACACCCCAGACTGG - Intronic
908096860 1:60748377-60748399 CACACACACACACACCTGGCTGG + Intergenic
908164160 1:61441283-61441305 CACACACACACACCCCTGCACGG - Intronic
909804903 1:79862636-79862658 CTCACACACAAAGCCCTGCATGG - Intergenic
909979360 1:82080298-82080320 CACACAAACAGATACCTCCTTGG - Intergenic
910845626 1:91602171-91602193 CACACACACACATGCCTACAGGG + Intergenic
910873027 1:91852299-91852321 CACACACACAGGTCCATACAGGG + Intronic
910938500 1:92507095-92507117 CACACACACACACACCAGCCAGG - Intergenic
911094543 1:94044830-94044852 AACTCTCACAGATTCCTGCCTGG + Intronic
911694272 1:100870772-100870794 CACACACAGATATCCCTTCCTGG + Intergenic
912998460 1:114555354-114555376 CACACACGCACAACCATGCCTGG + Intergenic
913069203 1:115284300-115284322 CACAGACACAGATCACTGGGAGG + Intergenic
915102307 1:153509213-153509235 CTCACACCCAGCTCCATGCCTGG - Intergenic
915127780 1:153678280-153678302 CACTCACTCAGTTTCCTGCCAGG + Intergenic
915217516 1:154349923-154349945 CACACACACATATCAATTCCTGG + Exonic
916630972 1:166612042-166612064 CACACACACACCTCCCTTCCTGG + Intergenic
916958716 1:169867438-169867460 CTCTCACACTAATCCCTGCCTGG - Intronic
917210692 1:172629021-172629043 CACACACACACATGCCTTTCAGG + Intergenic
918187181 1:182138275-182138297 CACACACAGAGATCAGAGCCTGG - Intergenic
919939472 1:202276395-202276417 CACTCACGGAGATCCCTGTCAGG + Exonic
920338015 1:205257882-205257904 CACACCCACAGATCCCAGTTGGG - Intronic
920817962 1:209353039-209353061 GACACATTCATATCCCTGCCTGG - Intergenic
921274792 1:213508518-213508540 CACACACACAAACCCCTTACTGG - Intergenic
921317812 1:213908624-213908646 CACACACAAAGGTCCCTCCAAGG - Intergenic
922091742 1:222401846-222401868 TACATACACAAATCCCTGCCTGG - Intergenic
922247475 1:223814527-223814549 CACACACACAGAGTCAAGCCAGG + Intronic
922471207 1:225878409-225878431 CACACACACATACCCCTCCTGGG + Intronic
922749474 1:228063858-228063880 CCCACACCCAGATCCAGGCCAGG + Intergenic
922795844 1:228339066-228339088 CACACACACACGTCCATGCATGG + Intronic
922796365 1:228341673-228341695 CAGCCGCACAGGTCCCTGCCTGG + Intronic
922998262 1:229984238-229984260 CACACACACACATCCCACCTTGG + Intergenic
923273627 1:232378798-232378820 CCCACAGACAGCCCCCTGCCTGG - Intergenic
923623550 1:235596239-235596261 CACACACACACACACCTGGCCGG + Intronic
924275954 1:242387212-242387234 GACACACACACAACCCTGCTGGG - Intronic
924473078 1:244360547-244360569 CACACACACACATGCATGCATGG + Intronic
924709966 1:246523533-246523555 GACACACACAGTTCCCTGTCTGG - Intergenic
924799339 1:247316181-247316203 CACACACACACACCCCTCCCAGG - Intronic
1062769728 10:89272-89294 CACACACACACACCCCTGCTGGG + Intergenic
1062780460 10:200196-200218 CACACACACACACCCTAGCCAGG - Intronic
1063139257 10:3242016-3242038 CACACACACAGATCAGTGTGAGG + Intergenic
1064082755 10:12321808-12321830 CACAGACTCAGATACCTGCATGG + Intergenic
1064323679 10:14329470-14329492 CTCACACACAGATAAATGCCTGG + Intronic
1064821433 10:19339069-19339091 CACACACACACATCCCTAGGAGG + Intronic
1067066961 10:43109614-43109636 CACACTTGCAGATCCCTGTCAGG - Intronic
1067188235 10:44048236-44048258 AACACAGTCAGATCCCTGTCTGG - Intergenic
1067272284 10:44802809-44802831 CACACACGCACATCCCTGAAGGG - Intergenic
1067852202 10:49761333-49761355 CCCACACACACAACCCTGTCTGG + Intronic
1068271125 10:54726410-54726432 CACACACACACACCCCTGATGGG - Intronic
1069738185 10:70671174-70671196 CTCACACACAGAATCCTGTCTGG + Intergenic
1069873702 10:71548580-71548602 CACACACCCAGAGACCTGCAGGG - Intronic
1070224899 10:74493341-74493363 CACACACACACATACATGCTGGG - Intronic
1070613866 10:77953832-77953854 CACACTCACAGATCTCTGATGGG + Intergenic
1070636392 10:78131699-78131721 CACACACACACATCCCTTCCAGG + Intergenic
1070849569 10:79552536-79552558 CACATGCACAAAGCCCTGCCAGG - Intergenic
1071362417 10:84862630-84862652 CCTACACTCACATCCCTGCCTGG - Intergenic
1073139823 10:101239723-101239745 CACACACACACATCCCTACCTGG + Intergenic
1074556012 10:114490962-114490984 CACACACACATATATATGCCGGG - Intronic
1075318303 10:121469531-121469553 CACAACCACAAATACCTGCCTGG + Intergenic
1075635480 10:124027553-124027575 CAATCACACAGAGCCCTGGCGGG - Intronic
1075943875 10:126415425-126415447 CACACACACAAAACTCTACCAGG - Intergenic
1076203740 10:128578574-128578596 CACAGACACAGATCTTTGACTGG + Intergenic
1076206198 10:128605988-128606010 CACACACACAAATCCTAGCATGG + Intergenic
1076619025 10:131775211-131775233 CACAGACACTGATCCTTGTCTGG + Intergenic
1076776319 10:132699951-132699973 GCCACACTCAGACCCCTGCCAGG - Intronic
1076877361 10:133222615-133222637 CACACACACAGACACACGCCGGG - Intronic
1076877515 10:133223629-133223651 CACACACACAGACACACGCCGGG - Intronic
1077026384 11:441807-441829 CACACACACAGGCGCCTTCCAGG + Intronic
1077152517 11:1078587-1078609 CACAGACACAGCTCCCACCCGGG - Intergenic
1077266032 11:1650748-1650770 CACACCCAGAGGTTCCTGCCTGG + Intergenic
1077312245 11:1894159-1894181 CACACACACACATTCCAGCCTGG - Intergenic
1077314981 11:1915519-1915541 CACACACACAGAAACATCCCAGG - Intergenic
1077320704 11:1939752-1939774 CACACACACAGAAACATCCCAGG + Intergenic
1077549861 11:3195393-3195415 CTCCCACACTGACCCCTGCCGGG + Intergenic
1078606642 11:12783086-12783108 CACACACACAAACCCTTACCTGG - Intronic
1079355630 11:19728080-19728102 CACACACACAGAAACCTTCTTGG - Intronic
1079452246 11:20607091-20607113 CACAGACACTGGTCCCTGGCTGG - Exonic
1079597778 11:22272337-22272359 CACACACACAGCTGGCTGCTGGG + Intronic
1083738733 11:64696554-64696576 CACACACACACCTGCCTGCTGGG + Intronic
1083773805 11:64883381-64883403 CACACACACAGAAAACTGGCAGG - Intronic
1084329379 11:68421676-68421698 CACACACACACAGCCTTGCTGGG - Intronic
1084432810 11:69121087-69121109 CCCACACACACGTACCTGCCTGG + Intergenic
1084432816 11:69121143-69121165 CCCACACACACGTACCTGCCTGG + Intergenic
1084601912 11:70150675-70150697 CAGACACACACAACCATGCCTGG + Intronic
1084932056 11:72563973-72563995 CACACACACAGGTGGATGCCAGG - Intergenic
1085640495 11:78189699-78189721 CACACACACCTATCCCTGCGGGG - Intronic
1085741004 11:79078341-79078363 CACACACACAGATGCTACCCAGG - Intronic
1085931713 11:81091462-81091484 CACACACAGTGACCCCGGCCAGG - Intergenic
1087986906 11:104693932-104693954 CACACACACACATACCTTACAGG + Intergenic
1089509936 11:118990473-118990495 CAGACACACACAATCCTGCCTGG + Intergenic
1089593355 11:119559431-119559453 CACACACAGACATCCCTCCAAGG + Intergenic
1090470003 11:126972224-126972246 CACACACACTGATCTCCCCCAGG + Intronic
1090933723 11:131323440-131323462 CAAACACACATATAGCTGCCTGG - Intergenic
1091180188 11:133597106-133597128 CTCAAAAACATATCCCTGCCAGG - Intergenic
1091775589 12:3182750-3182772 CCCAGTCACAGATCCCCGCCTGG - Intronic
1092160879 12:6314923-6314945 CACACACACACAGCCCTCCCGGG + Intronic
1092452477 12:8615812-8615834 CACACACACATATCCATACAAGG - Intergenic
1094299167 12:28941637-28941659 CACACACACAAATGCAAGCCAGG - Intergenic
1095400996 12:41814465-41814487 GACACACACAGATCAGTTCCAGG + Intergenic
1096599610 12:52720221-52720243 CAGACACCCAGATGTCTGCCAGG + Intergenic
1096839781 12:54373113-54373135 CACACACACAGAACCCCCTCAGG - Intronic
1097723107 12:63045197-63045219 CACACACACACACCCCTTACTGG + Intergenic
1098153423 12:67572145-67572167 CAAACACACACAACCATGCCTGG + Intergenic
1098972343 12:76869567-76869589 CACACACACACACCCCTGACTGG + Intronic
1099602935 12:84764301-84764323 CACCCACAGAAATTCCTGCCAGG - Intergenic
1100386319 12:94107386-94107408 CACACACACACAACAGTGCCTGG + Intergenic
1101006394 12:100405182-100405204 CAGGCCCACACATCCCTGCCTGG - Intronic
1101837027 12:108303003-108303025 CAAACACTCCGATCCCTGCCTGG + Intronic
1102036101 12:109771346-109771368 CCCATTCACAGAGCCCTGCCAGG + Intergenic
1102163290 12:110786427-110786449 AACACACTCAGAAACCTGCCTGG - Intergenic
1102260484 12:111440270-111440292 CACACACACTGCTCCTTGCACGG + Intronic
1102695845 12:114798771-114798793 CACACACACACACACCTGCCCGG - Intergenic
1103161437 12:118732602-118732624 CACACACACACACACATGCCAGG + Intergenic
1103348705 12:120267924-120267946 CGAACACTCAGGTCCCTGCCAGG + Intergenic
1104949611 12:132433472-132433494 AACACACACACATGCCTACCAGG - Intergenic
1105226745 13:18442054-18442076 CTCACACACAGAGACCTGTCAGG + Intergenic
1105960643 13:25333112-25333134 CACACACACAAACCCTTGACAGG - Intronic
1106149421 13:27084209-27084231 CACACACACAAATTCCTGTCTGG + Intronic
1106284131 13:28304353-28304375 CACACACGCAGATGTTTGCCTGG + Intronic
1106355935 13:28983187-28983209 CTCACACAGAGGTCCCTGGCAGG + Intronic
1107049438 13:36031862-36031884 CTCCCACCCAGATCCCTGCTAGG + Intronic
1107325818 13:39241129-39241151 CAGATACTCAGATGCCTGCCAGG + Intergenic
1107734149 13:43378372-43378394 CACACAAACACATCTCTCCCTGG + Intronic
1108563469 13:51670528-51670550 CACACACACAGATGTTTGCCTGG + Intronic
1108721154 13:53134023-53134045 CACACACACACACACCTGCAGGG - Intergenic
1110141622 13:72137737-72137759 CACACACACACATCCCAGGCTGG - Intergenic
1110243326 13:73292989-73293011 CACACACACACATATATGCCAGG - Intergenic
1111236275 13:85412539-85412561 CACACACACATATTACTTCCTGG + Intergenic
1111658109 13:91176720-91176742 CACACACACACACCCCTACATGG - Intergenic
1112512482 13:100021972-100021994 CACACACACACACACCTGCCAGG - Intergenic
1113220812 13:108099682-108099704 CACACACACACATCTCTTCTAGG + Intergenic
1114761666 14:25322668-25322690 GACATACTCAGATACCTGCCAGG - Intergenic
1115649770 14:35394615-35394637 CACACAGACAGAACCCTTCATGG + Intergenic
1117209375 14:53480074-53480096 CACACACACACACACCTACCTGG + Intergenic
1117394338 14:55293851-55293873 CACACACACAAATCTGTGCTAGG - Intronic
1117398974 14:55340686-55340708 CACACACACAAATCCCTGGCTGG - Intronic
1118148314 14:63164193-63164215 CACAACCCCAGATCCCTCCCAGG + Intergenic
1118284335 14:64457749-64457771 CTCAGAAACTGATCCCTGCCGGG - Intronic
1118463594 14:66010596-66010618 CACACACACAGCTGCATGGCTGG + Intergenic
1119326159 14:73760572-73760594 CACACACACACTTTCCTGGCAGG - Intronic
1119477694 14:74940593-74940615 CACACACACACACCCCTTGCAGG + Intergenic
1119514521 14:75237467-75237489 CACACACACAGAGTTCTGTCTGG + Intergenic
1120560063 14:85980518-85980540 CACACACACACACCCCTGGATGG + Intergenic
1121075141 14:91061166-91061188 CACACGCATGGATCGCTGCCGGG - Intronic
1121782975 14:96634429-96634451 CACACACACACATGCCTGCCAGG + Intergenic
1121860859 14:97316714-97316736 CACACACACACACCCCTCCCGGG - Intergenic
1121916834 14:97843259-97843281 CACACACACAGATACAGCCCTGG + Intergenic
1121923849 14:97909685-97909707 AACACACACTGAGCCCTGTCAGG - Intergenic
1122320634 14:100853248-100853270 CCCACACACAAATCCTTTCCTGG + Intergenic
1122787537 14:104170899-104170921 CACACACACAGATCTCAAACTGG - Intronic
1123430235 15:20208747-20208769 CACACACACACACACCAGCCAGG + Intergenic
1123584171 15:21742314-21742336 CAGACACAAACCTCCCTGCCAGG - Intergenic
1123620821 15:22184917-22184939 CAGACACAAACCTCCCTGCCAGG - Intergenic
1124235102 15:27983590-27983612 CACACACACACACCCCTGTGGGG + Intronic
1124789976 15:32718177-32718199 CGCCCACTCACATCCCTGCCGGG - Intronic
1126066741 15:44831522-44831544 CACTCACGTAGATGCCTGCCTGG + Intergenic
1127666891 15:61156541-61156563 CACTCCCACAGATTCCTGCTGGG - Intronic
1128153112 15:65376035-65376057 CACACACCCTGCTCCCTGCCAGG - Intronic
1128627482 15:69224689-69224711 CACATGCACAGCTGCCTGCCAGG + Intronic
1128771902 15:70289194-70289216 CCCCCCCATAGATCCCTGCCTGG + Intergenic
1128870578 15:71152578-71152600 CACACTCCTAGTTCCCTGCCCGG + Intronic
1128957735 15:71966258-71966280 CACACACACACACACTTGCCTGG - Intronic
1130101908 15:80900576-80900598 CACACACACACACCCCTACCTGG - Intronic
1130664529 15:85858689-85858711 CACACACACACACCACTGCTGGG - Intergenic
1130836661 15:87656471-87656493 CACACACACATGCCCATGCCTGG - Intergenic
1131018224 15:89075399-89075421 CACCCACACACTTCCCTACCTGG - Intergenic
1131167418 15:90152475-90152497 CATGCACACAGTTCCCTCCCAGG - Intergenic
1131238343 15:90716837-90716859 CACACACTCAGATGCCTCCATGG - Intergenic
1131622332 15:94081241-94081263 CCCACACAGAGGTCCCGGCCAGG - Intergenic
1132457162 16:30540-30562 CACACACACGAATCGCTGTCAGG + Intergenic
1132461584 16:57957-57979 CTGACACTCAGTTCCCTGCCCGG + Intergenic
1132468094 16:86870-86892 CACACCCACCCATCCCTTCCAGG - Exonic
1132566229 16:624776-624798 CTCACACTCAGAGCCCTGTCGGG - Intronic
1132606304 16:795172-795194 CACACACACAGCACCCAGGCTGG - Exonic
1132798806 16:1741411-1741433 CACCCACACAGCTCCATGCTGGG - Intronic
1133302053 16:4788324-4788346 CACACACACCAGGCCCTGCCAGG - Exonic
1133983753 16:10652548-10652570 CACACACACACACCCCCTCCAGG + Intronic
1134002652 16:10794743-10794765 GACAGACACAGACCCCTACCAGG - Intronic
1134044647 16:11092387-11092409 CACACACACACACACATGCCAGG + Intronic
1134313721 16:13099291-13099313 CACACACACACATCTCTGATGGG + Intronic
1134315867 16:13118296-13118318 CACACACATACCTCCCTGTCAGG - Intronic
1134665498 16:16015606-16015628 CACATACACAGTCCCCTGCGAGG - Intronic
1135548591 16:23381430-23381452 GACACTCACTGATCCCTGCCTGG + Intergenic
1135620155 16:23948891-23948913 CACACCCACAAATCTCTGACAGG - Intronic
1136033164 16:27518194-27518216 CACACACACACACACATGCCTGG + Intronic
1136288969 16:29260310-29260332 CACACACAAAGAACCCGGCGGGG - Intergenic
1136854402 16:33642462-33642484 CACACACACACACACCAGCCAGG - Intergenic
1137375948 16:47951935-47951957 CACACACACATAGTCCAGCCTGG - Intergenic
1137721171 16:50628349-50628371 CACTCACCCACATGCCTGCCTGG + Intronic
1138330320 16:56209489-56209511 CACACACACACATCCCTATTAGG + Intronic
1138535025 16:57655305-57655327 CACACACACCCATCCGTTCCTGG - Intronic
1138709892 16:58959819-58959841 CACACACACACACCCCTACACGG - Intergenic
1139833853 16:69822523-69822545 CACACACACACACCCCACCCAGG - Intronic
1139971379 16:70777726-70777748 CACACACAAAGGTTCTTGCCCGG + Intronic
1140480017 16:75257305-75257327 CACACTCACAGATACCCACCCGG + Intronic
1141189485 16:81814115-81814137 CTAACACACAGACCCCAGCCTGG - Intronic
1141378620 16:83554997-83555019 CACACAGACAGAACCCTGCGGGG + Intronic
1141436976 16:84005450-84005472 CCCACCCACAGATGCCTCCCGGG - Intergenic
1141590415 16:85065155-85065177 CACACACACAGTAACATGCCCGG - Intronic
1141611417 16:85183252-85183274 CACACACTCACATTCTTGCCTGG + Intronic
1142227150 16:88883074-88883096 CACCCCCACCGCTCCCTGCCTGG - Intronic
1142310404 16:89309140-89309162 CCCACACACTGAGCCCTGGCAGG + Intronic
1203115981 16_KI270728v1_random:1490912-1490934 CACACACACACACACCAGCCAGG - Intergenic
1142524426 17:529411-529433 CACACACACACACCCCTGCTGGG + Intronic
1142752949 17:1999150-1999172 CACACACACACACACCGGCCGGG + Intronic
1143484512 17:7246185-7246207 CTCAAACCCAGATCCCTCCCTGG + Intronic
1143653355 17:8278095-8278117 CAGACACAGAGATCCCAGCCTGG + Intergenic
1143770123 17:9163173-9163195 CACACACACACACGCCTCCCTGG + Intronic
1143862039 17:9897972-9897994 CACACACACACATCCACCCCAGG - Exonic
1144783450 17:17819257-17819279 CACACACACACATGCCCACCTGG - Intronic
1146433461 17:32821557-32821579 CACACACACACATCTTTGACTGG + Intronic
1146631744 17:34474946-34474968 CAGAGACACAGGTCCGTGCCTGG + Intergenic
1146896193 17:36544210-36544232 CACACACACACACCACTGTCCGG + Intergenic
1147163375 17:38580299-38580321 CACACATACACACCCCTCCCTGG + Intronic
1147306632 17:39568727-39568749 CACACACACATGCCCCTGCATGG + Intergenic
1147438977 17:40435887-40435909 CACACACACACATTTCTGCTGGG + Intergenic
1148024547 17:44577352-44577374 CACACACACACATCCGGGCACGG + Intergenic
1148764850 17:50031748-50031770 CACACACACACATTCCTGCCAGG - Intergenic
1150552178 17:66221048-66221070 CAGACACACACCTCCATGCCTGG - Intronic
1151376492 17:73692315-73692337 CACACACACACTTCCCTGGAGGG + Intergenic
1151792663 17:76318785-76318807 GACACACAAAGATGACTGCCGGG + Intronic
1151975587 17:77482081-77482103 CTCACACACAGGCGCCTGCCAGG - Intronic
1152612910 17:81324301-81324323 CCCACACTCGGGTCCCTGCCCGG + Intronic
1152961148 18:81264-81286 CACACACACAAGTCGCTGTCAGG + Intergenic
1153515891 18:5900937-5900959 CACTCACCCAAATCCATGCCAGG - Intergenic
1153962152 18:10148997-10149019 CACACATATAGATTACTGCCAGG + Intergenic
1154209905 18:12370531-12370553 CACAATCACAGCTCCCTGCTGGG + Intronic
1154526638 18:15297420-15297442 CTCACACACAGAGACCTGTCAGG - Intergenic
1155440053 18:25852578-25852600 CACACACAAACACCCCTCCCTGG - Intergenic
1155551645 18:26971859-26971881 CACAGACAAAGATTTCTGCCTGG + Intronic
1156245356 18:35292310-35292332 CACACACACACCACCATGCCTGG - Intergenic
1156846220 18:41668269-41668291 CACACACACACATTCTTGCCAGG - Intergenic
1157504771 18:48218532-48218554 GGCACACACAGGGCCCTGCCTGG + Intronic
1158392294 18:57053291-57053313 CACACCCACAGATTGGTGCCAGG + Intergenic
1159381826 18:67669942-67669964 CACACACACACAGTCCTCCCTGG + Intergenic
1159416150 18:68152146-68152168 CACACACACATACCCCTCCTGGG + Intergenic
1159837483 18:73356634-73356656 CACACACACCTATGCCTGTCTGG + Intergenic
1160059214 18:75514524-75514546 CACAAACTCAGATCCCTTCCAGG + Intergenic
1160538236 18:79606778-79606800 CACACACAGGGAGCCCTGGCAGG + Intergenic
1160827543 19:1087713-1087735 CACACACACAGTCCGCGGCCTGG + Exonic
1160934756 19:1588820-1588842 GACACACACAGACCACAGCCTGG + Intronic
1160964475 19:1740500-1740522 CCCACCCACCGTTCCCTGCCTGG + Intergenic
1161828935 19:6588857-6588879 AACAGACAGAAATCCCTGCCTGG - Intronic
1161843715 19:6697780-6697802 CTGCCACACAGATCCCTGCTCGG + Exonic
1164825260 19:31280399-31280421 AACCCACACCTATCCCTGCCAGG - Intronic
1165766765 19:38356511-38356533 CTCGCACACAGACCACTGCCTGG - Exonic
1166214918 19:41328584-41328606 GACACACAGAGATTCCTGCAGGG - Intronic
1166315656 19:41988153-41988175 GACTCACACAGAACCCTCCCTGG + Intronic
1166343259 19:42151000-42151022 CACACACACATATCCATGGTGGG + Intronic
1166705782 19:44907261-44907283 CACCCCCACACAGCCCTGCCTGG + Intronic
1167526136 19:49984969-49984991 CACACACACACATCCTTCTCTGG - Intronic
1167632022 19:50631291-50631313 CAGACACACACAACCATGCCCGG + Intronic
1167897087 19:52590712-52590734 CACATCCACAGATACATGCCAGG - Intergenic
925054264 2:844236-844258 CACACACAAAGGTTCCTGCCAGG + Intergenic
925532768 2:4883423-4883445 CACACACCCTGAGCCCTGGCGGG - Intergenic
925745916 2:7043407-7043429 CACACACACAAAGCCCATCCTGG - Exonic
925766765 2:7243908-7243930 CACACACACGTGTCCTTGCCTGG + Intergenic
926339221 2:11890999-11891021 CACACGCCCACCTCCCTGCCTGG - Intergenic
926633525 2:15158389-15158411 CAGACACAAAGGCCCCTGCCTGG + Intergenic
927037206 2:19190382-19190404 AACACAGACAGAGCCATGCCAGG - Intergenic
927810440 2:26177637-26177659 CACACACACAGAACTGGGCCTGG - Intronic
928206507 2:29288352-29288374 CACACACCCATATCCCTCTCTGG + Intronic
928739332 2:34331635-34331657 CACACACACACATGCATGCACGG - Intergenic
929513701 2:42586605-42586627 CACACACACACATCGTTGGCTGG + Intronic
929593757 2:43162913-43162935 CACACACACACACAACTGCCAGG - Intergenic
930064846 2:47319961-47319983 AACACAAACAGAGCCCTGGCTGG + Intergenic
930104279 2:47627948-47627970 AACACCCACAGAACCATGCCAGG - Intergenic
931263800 2:60642725-60642747 CACACACACACATCAATGCCTGG + Intergenic
934076978 2:88436831-88436853 TACACTCACAGAAGCCTGCCTGG + Intergenic
934864836 2:97798416-97798438 AACACACACCGATCTATGCCAGG - Intronic
935301502 2:101697501-101697523 CTCACACCCCGAGCCCTGCCGGG - Intronic
935439473 2:103075675-103075697 CACACACACAAACCCCTGCAAGG - Intergenic
935569244 2:104641822-104641844 CTTACACACAGATCCCTGTGGGG + Intergenic
936006517 2:108893731-108893753 CACACACAAAGACTCCTGCAAGG + Intergenic
937296385 2:120812263-120812285 CACACACACATGTCGCGGCCCGG + Intronic
937904220 2:127045042-127045064 CACACACACAAATACTTTCCGGG + Intergenic
938525731 2:132128785-132128807 CTCACACACAGAGACCTGTCAGG - Intergenic
938749249 2:134313081-134313103 CACACACACACATATCTGTCTGG + Intronic
938773420 2:134520550-134520572 CACACACACAAAACTGTGCCAGG - Intronic
938827077 2:135016534-135016556 CACACACACACAAACCTGCTAGG + Intronic
939226180 2:139367549-139367571 CAGACACACAGAATCATGCCTGG - Intergenic
939713110 2:145548148-145548170 CACACACACACACCCCTACATGG - Intergenic
940592119 2:155742630-155742652 CCCACACCCAGAGCCCTTCCAGG + Intergenic
941788017 2:169520140-169520162 CACACACACAGAGCTAGGCCTGG - Intronic
942122796 2:172794668-172794690 CACAAACACAAATGCCTGCAGGG - Intronic
942451181 2:176108647-176108669 CACACACACAGAGCCTGGCACGG - Intronic
943586152 2:189742969-189742991 CACACACACACACCCCTGAAAGG + Intronic
943757847 2:191575743-191575765 CACACACACACACCCCTGGATGG + Intergenic
944460965 2:199950209-199950231 CACACACACATATACCTAACAGG + Intronic
945214958 2:207423509-207423531 CACACACACACAGCCCAGCGTGG - Intergenic
946167525 2:217874045-217874067 CACACACACAGCTAGCAGCCAGG + Intronic
946543347 2:220710139-220710161 CACATAAACATATCCCTGCAAGG + Intergenic
946733915 2:222735241-222735263 CACACACACACACACATGCCTGG - Intergenic
946861539 2:224004245-224004267 CACACGCAGAACTCCCTGCCTGG + Intronic
947851155 2:233289367-233289389 CACACACACACATCCCAAACAGG - Intronic
948074619 2:235156223-235156245 CACTCACACAGATATTTGCCTGG - Intergenic
948193503 2:236078146-236078168 CACACACACACACCCCCGGCTGG - Intronic
948401214 2:237686911-237686933 CACACACCCAGGTCAATGCCAGG - Intronic
948981221 2:241495901-241495923 CACACACAGGGACCCCTTCCCGG - Intronic
949001288 2:241615715-241615737 GCCACACACAGCGCCCTGCCCGG + Intronic
1168771086 20:417383-417405 CACACACACAAACCCCAGTCTGG - Intronic
1169157991 20:3350182-3350204 CACACACACAAATTCTGGCCAGG + Intronic
1169867432 20:10217301-10217323 CACACACACACATCCCTAGCTGG - Intergenic
1170164084 20:13344290-13344312 CACACACACACCCTCCTGCCTGG + Intergenic
1170436376 20:16334133-16334155 CACACACACACATTCATTCCAGG - Intronic
1170557618 20:17528121-17528143 CACACATACACATACATGCCAGG - Intronic
1170784050 20:19452366-19452388 CACACACACACATCCCCCACAGG - Intronic
1171148175 20:22803878-22803900 CACAAACACAGAGGCCTGCCAGG + Intergenic
1171269682 20:23804132-23804154 CAGAAACACAGATATCTGCCTGG + Intergenic
1172036651 20:32015586-32015608 CACACACACATATTCCTGCAAGG - Intronic
1172146603 20:32762284-32762306 CAGCCACTCAGATCCCCGCCCGG - Intergenic
1172322020 20:34002772-34002794 CACCCACACAGTTCTCTGGCTGG + Intronic
1172430919 20:34890912-34890934 CACACACACATATGCCTACAAGG - Intronic
1172448202 20:35003909-35003931 CACACGCACCCAGCCCTGCCTGG - Intronic
1172587378 20:36093888-36093910 CACCCACCCAGAGCCCTGCACGG - Intronic
1173038000 20:39431026-39431048 CACACACACAGAGACCACCCAGG - Intergenic
1173163964 20:40673209-40673231 CACACACACACATGCATACCAGG + Intergenic
1173170317 20:40718055-40718077 CACACACACACATCACTCTCAGG - Intergenic
1173516289 20:43667395-43667417 CACACACACACACCCCAGCTTGG - Intronic
1174180154 20:48669354-48669376 CACACACTCAGTACCCTGCAAGG + Intronic
1174187654 20:48718119-48718141 CACAAACACAGATACCTGCAGGG - Intronic
1175258470 20:57660981-57661003 CACACACACACATCCATCCCAGG + Intronic
1175593317 20:60211143-60211165 CACACACACACACCCATCCCTGG - Intergenic
1175829045 20:61952117-61952139 CACACACACACAGCCCTCCTCGG + Intergenic
1176014376 20:62922267-62922289 CACACACACAGGTGTCTACCTGG + Intronic
1176070154 20:63222103-63222125 CCCACACCCAGGTCCCTGCTGGG + Intergenic
1176770795 21:13071078-13071100 CTCACACACAGAGACCTGTCAGG + Intergenic
1176994265 21:15536264-15536286 CACACACACAGATGTCTGGTGGG + Intergenic
1177399882 21:20588604-20588626 CACACACATATACCCCTCCCGGG - Intergenic
1177408611 21:20701634-20701656 CACACACACACACGCCTCCCTGG + Intergenic
1177915081 21:27079341-27079363 CACACACACACATGCATGCATGG + Intergenic
1179522781 21:41955889-41955911 CACACACACAAAACTCAGCCGGG + Intergenic
1179543579 21:42100123-42100145 CACAGCCACAGATGCCAGCCTGG - Intronic
1179769437 21:43603449-43603471 GAAACAGACAGAACCCTGCCAGG + Intronic
1179837469 21:44046375-44046397 CACACCCACAAATCTCTGACTGG - Intronic
1180133350 21:45842842-45842864 GACGCACACAGCACCCTGCCCGG - Intronic
1181489208 22:23251171-23251193 CACAGAGACAGAACCCGGCCCGG + Intronic
1181694954 22:24588402-24588424 CACACACACACTTGGCTGCCTGG - Intronic
1181816141 22:25438071-25438093 AACACACACAGGACCCTGCCAGG + Intergenic
1182298857 22:29327054-29327076 CACACACACCGCTGCCTTCCTGG - Intergenic
1182909927 22:33974325-33974347 CACACACACAAATGCCAGCATGG + Intergenic
1183012187 22:34955905-34955927 CACACACACAGAGGCCTGTTGGG + Intergenic
1183089539 22:35511977-35511999 CACACACACACATACTTGCAGGG - Intergenic
1183172025 22:36195325-36195347 CACACGCACAAATCTCTTCCAGG + Exonic
1183733827 22:39632560-39632582 CACACACAGAGCTCACAGCCTGG - Intronic
1183737876 22:39653891-39653913 GTCACACACAGGCCCCTGCCTGG - Intronic
1185312032 22:50161548-50161570 CACCCACACACGACCCTGCCTGG - Exonic
1185362843 22:50419318-50419340 CACACACAGAGGTCACTGCCTGG - Intronic
949403054 3:3685109-3685131 CACACACACATATGTGTGCCTGG - Intergenic
949519777 3:4839470-4839492 CACACACACACACCCCTGACTGG - Intronic
950516525 3:13469875-13469897 CACACACACAAACACCAGCCAGG - Intergenic
951776375 3:26314796-26314818 CACACACACAGAAATCTGCGGGG - Intergenic
952077918 3:29720684-29720706 CACACACACAGATTCTTACAGGG - Intronic
953607030 3:44418951-44418973 CACACAAACATATCCTGGCCTGG + Intergenic
955260191 3:57381225-57381247 CACACACACACCTCCCTATCAGG - Intronic
955350143 3:58187634-58187656 CACACACACACCCCTCTGCCAGG - Intergenic
955369050 3:58335011-58335033 CACACACACACACACCAGCCTGG - Intronic
955683179 3:61523996-61524018 CACACACACACACCCCATCCTGG + Intergenic
955746244 3:62143066-62143088 CTCCCGCTCAGATCCCTGCCAGG + Intronic
957388524 3:79530794-79530816 CACACACACACATCCTTCCCTGG + Intronic
959027411 3:101256371-101256393 CACATACACATATAACTGCCTGG + Intronic
959104946 3:102054886-102054908 CACAGACAGTGATCCCTGCCAGG + Intergenic
960141315 3:114154313-114154335 CACACACACATCTCCCACCCTGG - Intronic
960296914 3:115955633-115955655 CACACACACAACTACCTGCTGGG - Intronic
961812594 3:129530561-129530583 CACACACAAAACTCCCTACCGGG + Intronic
962262986 3:133926844-133926866 CAGACAGACAGATGCCTGCATGG - Intergenic
962328834 3:134459665-134459687 CACACACACACACCCCTGGATGG - Intergenic
962456452 3:135569499-135569521 CAGACACACAGATCCCAGACAGG + Intergenic
962534303 3:136314037-136314059 CACACACACACATCCCTAAAAGG + Intronic
963310724 3:143707389-143707411 CACACACACACACCCCAGCTGGG + Intronic
963808498 3:149751308-149751330 AAAACACACAGGTACCTGCCAGG + Intronic
964442844 3:156729665-156729687 CACATACTCACATTCCTGCCGGG - Intergenic
964508936 3:157428263-157428285 CACACACAAAGAAACATGCCTGG + Intronic
964907926 3:161741364-161741386 GATACACACAGATCCTTTCCAGG + Intergenic
965394531 3:168146184-168146206 CACACACACACACACCTGCTAGG - Intergenic
965602666 3:170470296-170470318 CACACACACATGTTCCTTCCAGG - Intronic
966207392 3:177419294-177419316 CACACACACCCACCCCTGCACGG - Intergenic
968626121 4:1627483-1627505 CACACACCCAGTCCCCTGCTTGG + Intronic
968736469 4:2299542-2299564 CACAAACACAGCTCCCTGTCTGG - Intronic
968915309 4:3494677-3494699 CACACATGCACATCCCAGCCCGG - Intronic
970547178 4:17141618-17141640 CACACACACGGATTTCTGCTGGG + Intergenic
970986272 4:22162537-22162559 CACACACACAGACACCTCCATGG + Intergenic
971326782 4:25650964-25650986 CACACAAACTGATCTCTGCCAGG + Intergenic
972569521 4:40297624-40297646 CACACACACAGATGCATACATGG - Intergenic
978001499 4:103559468-103559490 CACACACACACATACATGTCAGG - Intergenic
978561934 4:110042688-110042710 CCCACCCACCCATCCCTGCCAGG - Intergenic
979139194 4:117151115-117151137 CACCCACACAGAGTCCTGACTGG - Intergenic
979160800 4:117458808-117458830 CACACACACAAAACCCTCACAGG + Intergenic
979323672 4:119353659-119353681 CAAACACACAAATGCCTGCCGGG - Intergenic
980602997 4:135050006-135050028 CACACACACAGATACATACAGGG - Intergenic
980755798 4:137158440-137158462 CACACACACAAAACCCAGCCAGG - Intergenic
980842333 4:138278951-138278973 CAATCACGAAGATCCCTGCCAGG + Intergenic
981734543 4:147935212-147935234 CACACGCACACATCCATGACGGG - Intronic
982503086 4:156184008-156184030 CACACACACACATCCCTATGTGG - Intergenic
982617935 4:157665364-157665386 CACACACACACACACCTGACAGG + Intergenic
983241502 4:165238325-165238347 CAAACACACAAATGCCTGCCGGG - Intronic
983824576 4:172242299-172242321 CACACACACACATCTCTGAATGG - Intronic
985477326 5:85519-85541 CACACTCCCCGATCTCTGCCTGG - Intergenic
985619710 5:947865-947887 AAACCACACAGATCCCTCCCGGG + Intergenic
985653740 5:1119432-1119454 GGCACGCACACATCCCTGCCCGG + Intergenic
985764032 5:1767697-1767719 CCCACACACAGGGCCCTCCCAGG - Intergenic
985869079 5:2539489-2539511 CACACACACACATATCTGCTGGG + Intergenic
986083632 5:4420067-4420089 CACACACACATACACATGCCAGG - Intergenic
986196151 5:5537804-5537826 CACAGACTCAGCTCCCTTCCAGG - Intergenic
986517899 5:8582429-8582451 CTCACACACAGAAACCAGCCTGG - Intergenic
988254574 5:28805053-28805075 CACACACACAGGGGCCTGTCAGG + Intergenic
988840787 5:35081802-35081824 CACACACACACACCCCTCCTGGG + Intronic
989644262 5:43612446-43612468 CACACTCAAAGTTCCCTTCCAGG - Intronic
989711037 5:44397516-44397538 CACACACACACACCCCTTCAAGG + Intergenic
990257829 5:53989567-53989589 CACACACACACACCCCTCCCTGG - Intronic
990682357 5:58259470-58259492 CACTCCCACAGATGGCTGCCTGG + Intergenic
992936365 5:81710975-81710997 CAAACATACAGTTCCTTGCCTGG - Intronic
994665771 5:102703679-102703701 CACACACAGGCATTCCTGCCTGG - Intergenic
995036621 5:107541628-107541650 CACACACACAAATCCCAGATTGG + Intronic
995480419 5:112586888-112586910 CACACTTACACTTCCCTGCCTGG + Intergenic
995486042 5:112641039-112641061 GACAGACAGAGTTCCCTGCCTGG + Intergenic
995552240 5:113293238-113293260 CACACACACACACCCCCGCAGGG + Intronic
995607085 5:113868664-113868686 CACAAATACTGATCCCTACCTGG - Intergenic
996520538 5:124420974-124420996 CCCACTCACAGATACCTGCCTGG - Intergenic
997378879 5:133421116-133421138 CCCACACCCAGGCCCCTGCCAGG - Intronic
998126573 5:139627007-139627029 CACACACACACTTCTCTGCTAGG - Exonic
998386761 5:141761654-141761676 CACACACACACACCCTTTCCCGG - Intergenic
998808637 5:145943199-145943221 CACACACACAGAAACATGCAGGG + Intronic
999374256 5:151075935-151075957 CCCACACACACACCCCTGCCTGG + Intronic
999404898 5:151298261-151298283 CACACACTCAAATGCCTGCAGGG + Intronic
999611728 5:153377084-153377106 CACACACACACACCCCTTACGGG - Intergenic
1000039668 5:157475915-157475937 CCCACTCACACATCCCTACCTGG - Intronic
1000110758 5:158106075-158106097 CACACACACGGCTATCTGCCAGG - Intergenic
1001101513 5:168818315-168818337 GAAACACACAGATCCCTCCAGGG - Intronic
1001273170 5:170331280-170331302 CACACAAACACACCCCTTCCTGG + Intergenic
1001554734 5:172629070-172629092 CACACACACACACCCCTGTTAGG + Intergenic
1001732467 5:173970422-173970444 CACACACACACATACATCCCAGG - Intergenic
1001761897 5:174214372-174214394 CACCCACACAGCTCCCTGGGAGG - Intronic
1001961058 5:175880555-175880577 CTCCCACCCAGATCCCAGCCTGG - Exonic
1002166759 5:177352313-177352335 AACAGACACAGATCCTGGCCTGG + Intergenic
1003134328 6:3422330-3422352 CACACACACAGAGTCCACCCTGG + Intronic
1003708755 6:8565357-8565379 CACACACACACACCCCTACCAGG - Intergenic
1003942424 6:11043424-11043446 CACACACACAGCTTACTGTCAGG + Intronic
1004282638 6:14293938-14293960 CACACACACACACCCTAGCCTGG + Intergenic
1005375939 6:25182250-25182272 CACACACACACTTCTCTGCTAGG - Intergenic
1006075327 6:31528983-31529005 AGCTCACACAGCTCCCTGCCAGG + Exonic
1006105569 6:31714244-31714266 CACTCAAACAGATCCACGCCGGG - Intronic
1006105874 6:31715941-31715963 CACACACACACACCCCTCCCTGG - Intronic
1006171454 6:32095737-32095759 CACACACACACTGGCCTGCCCGG + Intronic
1006253095 6:32807321-32807343 CACACACACAGTTGCCAGCAGGG - Intergenic
1006337647 6:33428693-33428715 CCCACACACAGAAGCCTGACAGG - Intronic
1006838367 6:37012950-37012972 CACACACACAGAACTTTTCCAGG - Intronic
1007693905 6:43719694-43719716 CCCACCCACAGATCCCTGCCTGG + Intergenic
1009976099 6:70672709-70672731 CACACACCCTGCTGCCTGCCAGG - Intronic
1012098488 6:94997988-94998010 CACACACACACATCTCAGACAGG - Intergenic
1012313665 6:97758804-97758826 CACACACACAAATCCCTTCCTGG + Intergenic
1013193519 6:107824989-107825011 CACACACACACATACAGGCCTGG - Intergenic
1014613092 6:123568400-123568422 CACCCACACAGATTCCTCACTGG - Intronic
1014743501 6:125172446-125172468 CACACACAAAAATCCAGGCCAGG - Intronic
1014934948 6:127376118-127376140 CACACACACAGGGCCGGGCCTGG - Intergenic
1016789799 6:148056171-148056193 CACACACACAGATCAAATCCAGG - Intergenic
1017515100 6:155149235-155149257 CTCACACACAGATCCCCTCGTGG - Intronic
1017648005 6:156556726-156556748 GACTCACACAGCTCCCAGCCTGG + Intergenic
1018161088 6:161042931-161042953 CACACACACACATCCCTGTTAGG + Intronic
1018357967 6:163037746-163037768 CACACACACAGTTTCCACCCTGG + Intronic
1018736300 6:166689366-166689388 CACGCACACATATCCGTGGCAGG - Intronic
1018790989 6:167147511-167147533 CACACACATACATGCCTGCAGGG + Intronic
1019151083 6:170006317-170006339 CCAGCACACAGAGCCCTGCCTGG + Intergenic
1019209084 6:170390223-170390245 CACACACACAGATTCCAGAGTGG + Intronic
1019611454 7:1938918-1938940 CACACACACACATACAGGCCAGG + Intronic
1019708671 7:2508408-2508430 CACACACCCAGAGCCCGACCCGG - Intergenic
1019758356 7:2789769-2789791 CACACACACACATCACCACCAGG - Intronic
1019980572 7:4618846-4618868 CACACACACAGAGCCAGGCGTGG + Intergenic
1020094299 7:5359834-5359856 CACACACACACATCTCTGTGCGG + Intronic
1020972186 7:14958464-14958486 CACACACACACACCCCGTCCAGG + Intronic
1021832556 7:24630309-24630331 ATCACACACCGATCCCTGTCGGG + Intronic
1022151008 7:27606336-27606358 AATAAACACAGATCCCTTCCTGG + Intronic
1022186332 7:27973274-27973296 CACACACACACACTCCAGCCTGG - Intronic
1023090582 7:36614320-36614342 CACACACATAAAGCCCTGCCCGG - Intronic
1023432617 7:40110502-40110524 CACACACACACAGACCTGCTAGG - Intergenic
1024294653 7:47832598-47832620 CAAAGCCACACATCCCTGCCAGG + Intronic
1024463896 7:49688625-49688647 CACACACACAGTTGCCTGGTTGG - Intergenic
1026856570 7:73758992-73759014 CACCCACAAAGCCCCCTGCCAGG - Intergenic
1026899490 7:74028850-74028872 CACACACACAAATGCATACCAGG - Intronic
1027754694 7:82197911-82197933 CACACACACATATGTCTACCTGG + Intronic
1028380678 7:90195350-90195372 CACACACACAAATACCTCACAGG + Intronic
1029260938 7:99302353-99302375 CACACACACACATCCCAACCTGG + Intergenic
1030238686 7:107294869-107294891 CACACACACAAATCCAGGCATGG - Intronic
1030267576 7:107636107-107636129 CAGGCACACAGCTCCATGCCTGG + Intergenic
1030562960 7:111114151-111114173 CACACACACACATTTTTGCCAGG + Intronic
1030820457 7:114086273-114086295 CACACACACAGATCCGGGTGGGG + Intergenic
1030903552 7:115153840-115153862 CACATACACACACCCCTGCATGG + Intergenic
1031818119 7:126465362-126465384 CACACACACACATCCCTACTGGG + Intronic
1031911031 7:127516799-127516821 CACACACACACATTCATGGCGGG + Intergenic
1032457910 7:132087559-132087581 AGCACACACAGATCCAGGCCAGG + Intergenic
1032471782 7:132184237-132184259 CACATGCACAGGGCCCTGCCTGG - Intronic
1033127431 7:138718188-138718210 CACACACACCCATTCCTTCCTGG - Intronic
1033286478 7:140045346-140045368 AAAACACTCAGATCACTGCCAGG - Intronic
1033600810 7:142887189-142887211 CACACACACACTCCCCTGGCTGG - Intergenic
1034417824 7:150974568-150974590 CACCCCCACAGAACCCTGCCCGG + Intronic
1035094514 7:156342637-156342659 CACTCACCCAAATCCCTGGCCGG + Intergenic
1035569144 8:660535-660557 CCCACACAGAGGTCCCAGCCCGG + Intronic
1035592033 8:823629-823651 GACACCCACACATCCCTGCTGGG - Intergenic
1035649616 8:1254938-1254960 CACACACACAGCACCCGGGCAGG - Intergenic
1035649622 8:1254970-1254992 CACACACACAGCACCCGGACAGG - Intergenic
1035649641 8:1255095-1255117 CACACACACAGCACCCAGGCAGG - Intergenic
1035649652 8:1255153-1255175 CACACACACAGCACCCGGGCAGG - Intergenic
1035649659 8:1255185-1255207 CACACACACAGCACCCAGGCAGG - Intergenic
1035649665 8:1255217-1255239 CACACACACAGCACCCAGGCAGG - Intergenic
1035649671 8:1255249-1255271 CACACACACAGCACCCGGGCAGG - Intergenic
1035649677 8:1255278-1255300 CACACACACAGCACCCAGGCAGG - Intergenic
1035649683 8:1255310-1255332 CACACACACAGCACCCGGGCAGG - Intergenic
1035649690 8:1255342-1255364 CACACACACAGCACCCAGGCAGG - Intergenic
1035649696 8:1255374-1255396 CACACACACAGCACCCGGGCAGG - Intergenic
1035649702 8:1255403-1255425 CACACACACAGCACCCAGGCAGG - Intergenic
1035649719 8:1255523-1255545 CAGACACACAGCTCCCAGGCAGG - Intergenic
1035649724 8:1255552-1255574 CACACACACAGCTCCCAGGCAGG - Intergenic
1035649736 8:1255642-1255664 CACACACACAGCGCCCGGGCAGG - Intergenic
1035649741 8:1255671-1255693 CACACACACAGCTCCCAGGCAGG - Intergenic
1035649754 8:1255758-1255780 CACACACACAGCACCCAGGCAGG - Intergenic
1035649783 8:1255938-1255960 CACACACACAGCACCCAGGCAGG - Intergenic
1035649793 8:1255997-1256019 CACACACACAGCACCCAGGCAGG - Intergenic
1035649798 8:1256026-1256048 CACACACACAGCACCCGGGCAGG - Intergenic
1035649808 8:1256087-1256109 CACACACACAGCGCCCGGGCAGG - Intergenic
1035649834 8:1256231-1256253 CACACACACAGCACCCGGGCAGG - Intergenic
1035649840 8:1256260-1256282 CACACACACAGCACCCAGGCAGG - Intergenic
1035649856 8:1256350-1256372 CACACACACAGCACCCGGGCAGG - Intergenic
1035649862 8:1256382-1256404 CACACACACAGCACCCAGGCAGG - Intergenic
1035649876 8:1256470-1256492 CACACACACAGCACCCAGGCAGG - Intergenic
1035649881 8:1256499-1256521 CACACACACAGCACCCAGGCAGG - Intergenic
1035972977 8:4272103-4272125 CACACACACACACCCCTGACAGG - Intronic
1036719172 8:11156852-11156874 CACACACACAGAGTCCTTCAGGG + Intronic
1040937792 8:52799410-52799432 GAAACACACAGATCACTGGCTGG - Intergenic
1041265497 8:56060415-56060437 CACACCCACAAACCCGTGCCAGG + Intergenic
1041275489 8:56153227-56153249 CACACACACACACCCCTACCTGG + Intergenic
1041419405 8:57649269-57649291 CACACACACACACCCCACCCTGG - Intergenic
1042311115 8:67380259-67380281 CACACACACACACACCTCCCAGG + Intergenic
1042393476 8:68263563-68263585 CAGGCACACACATCCATGCCCGG - Intergenic
1042586282 8:70342810-70342832 CACACACACACATCCCTACATGG + Intronic
1042847106 8:73179288-73179310 CACACACACACACCCCTACCTGG - Intergenic
1042862175 8:73325943-73325965 CACACACACACACCCCAGCCTGG - Intergenic
1043580369 8:81705220-81705242 CTCACTCACAGATCCCTGTCTGG - Intronic
1045884119 8:107076075-107076097 CACACAGACATATCCTTGCCTGG - Intergenic
1048154682 8:131934850-131934872 CACTCACACATATCCTTTCCAGG - Intronic
1048343539 8:133558882-133558904 CACACACAGTGGTCCCGGCCGGG - Intronic
1048809123 8:138269257-138269279 CACACTCACAGATCCCTCTGGGG - Intronic
1048865380 8:138757155-138757177 CATACACTCAGATCCCAGCGCGG + Intronic
1049532646 8:143162149-143162171 CACCCACACAGAGCCCTCCGGGG + Intergenic
1049735991 8:144205529-144205551 CACACACACGCATGCATGCCAGG + Intronic
1049786778 8:144454703-144454725 GACACTCACAGGGCCCTGCCTGG + Intronic
1050852674 9:10307233-10307255 CACACACACAAATCCTTCCCGGG + Intronic
1051566680 9:18507719-18507741 CACACACACAAATACATGCGTGG - Intronic
1051599249 9:18855813-18855835 TACACACAATGGTCCCTGCCAGG - Intronic
1052032108 9:23640435-23640457 CACACAGTAAGATCCCTGCCTGG - Intergenic
1053171654 9:35891326-35891348 CACACACACACATCCAGGCACGG + Intergenic
1053575885 9:39357372-39357394 CACACACACTGCCCCCTGCTGGG - Intronic
1053840401 9:42185309-42185331 CACACACACTGCCCCCTGCTGGG - Intronic
1054097454 9:60916063-60916085 CACACACACTGCCCCCTGCTGGG - Intergenic
1054118857 9:61191693-61191715 CACACACACTGCCCCCTGCTGGG - Intronic
1054588895 9:66990869-66990891 CACACACACTGCCCCCTGCTGGG + Intergenic
1054830336 9:69617957-69617979 CACACACACACAGCCCTCCTAGG + Intronic
1055986901 9:82062031-82062053 CACACACACTGCCCCCTGCTGGG + Intergenic
1056395120 9:86174881-86174903 CACAAACTCAGATACCTTCCAGG - Intergenic
1056584489 9:87919534-87919556 CACACACACTGCCCCCTGCTGGG - Intergenic
1056612377 9:88133386-88133408 CACACACACTGCCCCCTGCTGGG + Intergenic
1056722785 9:89085949-89085971 CACTCATACAGATCCATGGCTGG - Intronic
1056934771 9:90907888-90907910 CACACACACAGATTCCTAACAGG - Intergenic
1057160274 9:92884183-92884205 CACACACACTGCCCCCTGCTGGG - Intergenic
1057335444 9:94151516-94151538 CACACACACACATTCGTCCCTGG - Intergenic
1058058809 9:100474117-100474139 CACACACACAGATCCCTGCCTGG - Intronic
1058286284 9:103183744-103183766 CCCACACACAGCTGCCTGGCAGG + Intergenic
1058399842 9:104602746-104602768 CATGCACACAGATACATGCCTGG + Intergenic
1060011137 9:120043659-120043681 CACACACACAGCTCCTTGAGGGG - Intergenic
1060239816 9:121893338-121893360 CACACACACATATGCATGCATGG - Intronic
1060478534 9:124002399-124002421 CACACACACATTTCCCTTCCTGG - Intronic
1060760083 9:126239653-126239675 CACACACACACACCCCTCCACGG - Intergenic
1060765488 9:126292877-126292899 CACACACACTCACCCTTGCCTGG + Intergenic
1061209745 9:129183979-129184001 CACACACACACACACCAGCCCGG - Intergenic
1061799253 9:133105178-133105200 CACACACAGAGTTCCCTACAGGG - Intronic
1061858810 9:133457382-133457404 CACATACACGGCTCTCTGCCCGG - Intronic
1062035089 9:134379430-134379452 CACAGACACAGATGCCTGGATGG - Intronic
1062177623 9:135172982-135173004 CACACACCCAGAACCATGCTTGG + Intergenic
1062341735 9:136096509-136096531 CACACACACACTTCACTCCCTGG + Intergenic
1062352965 9:136148167-136148189 CACCCACACTGCCCCCTGCCTGG + Intergenic
1062385605 9:136310321-136310343 AACACACACACACGCCTGCCCGG + Intergenic
1062392040 9:136337735-136337757 CGGACACACAGATCTCTGGCCGG + Intronic
1062737011 9:138142872-138142894 CACACACACAAGTCGCTGTCAGG - Intergenic
1186021509 X:5261578-5261600 CACACACACACATTTCTGCTTGG - Intergenic
1186443908 X:9609402-9609424 CACACACACACACCCCTACCTGG - Intronic
1186495684 X:10011490-10011512 CACACACACAAAACACTGCAGGG - Intergenic
1186883991 X:13894185-13894207 CAGACACACTGATCCCCTCCAGG + Intronic
1187230822 X:17421254-17421276 CACACACACACACGCCAGCCTGG + Intronic
1187394429 X:18907275-18907297 CACAGACACCCATCCCTGTCTGG - Intronic
1187569489 X:20486613-20486635 CATACACACAGGTACATGCCAGG - Intergenic
1187824205 X:23318404-23318426 CACGCACACACATTCCTGCCTGG + Intergenic
1187940498 X:24376130-24376152 CACACACACAAATCTGTTCCAGG - Intergenic
1188170457 X:26918175-26918197 CACACACACACATCTATTCCTGG - Intergenic
1188712948 X:33424540-33424562 CAAACACACATATCCCAGTCAGG + Intergenic
1189132950 X:38519112-38519134 CACACACACACAGCCATTCCTGG - Intronic
1189893996 X:45634365-45634387 CACACACACACATGCCTGCTGGG + Intergenic
1190399071 X:50013667-50013689 CACACACTCAGATGCATGCCTGG + Intronic
1191854055 X:65608414-65608436 CACATACACATATTCCTGCATGG - Intronic
1192135371 X:68593587-68593609 CACACACACATATCCAACCCTGG + Intergenic
1192267574 X:69549675-69549697 CCCACCCTCAGATCCCTGCAGGG + Intergenic
1192741705 X:73899663-73899685 CACACACACACACACCTGCTGGG + Intergenic
1193575080 X:83186219-83186241 CACACATGCACATACCTGCCTGG + Intergenic
1194037313 X:88892156-88892178 CACACACACACACACATGCCTGG + Intergenic
1194045596 X:88997867-88997889 CACACACACATACACCTGCCAGG - Intergenic
1194140579 X:90204129-90204151 CAGACACGCAGAACCATGCCTGG + Intergenic
1194444094 X:93966151-93966173 GACACACACAGATTGCTTCCAGG + Intergenic
1194468029 X:94256586-94256608 CACAATCACAGAGCGCTGCCAGG + Intergenic
1194950612 X:100121552-100121574 CACACACACAAATCAGTCCCTGG - Intergenic
1195178067 X:102329725-102329747 CACACACACACACCCCTTGCTGG + Intergenic
1195180797 X:102357368-102357390 CACACACACACACCCCTTGCTGG - Intergenic
1196939862 X:120764703-120764725 CACACACAAAAATCCCTTCTAGG + Intergenic
1198948680 X:142043795-142043817 CATCCACACATTTCCCTGCCTGG - Intergenic
1200249066 X:154542545-154542567 CACACACCCAGCTTCCTTCCTGG - Intronic
1200399196 X:156008845-156008867 CACACACACGAATCGCTGTCAGG - Intronic
1200486343 Y:3773249-3773271 CAGACACGCAGAACCATGCCTGG + Intergenic
1200794170 Y:7325697-7325719 TACACACTCAGGGCCCTGCCAGG - Intergenic
1200800463 Y:7382495-7382517 CACACACACACACCCCTCCTGGG - Intergenic
1201503104 Y:14667461-14667483 CACACACACACATACATGCAGGG + Intronic
1202191612 Y:22251656-22251678 CAAACCCACAGCTCACTGCCTGG - Intergenic