ID: 1058058816

View in Genome Browser
Species Human (GRCh38)
Location 9:100474150-100474172
Sequence GCGGTGGGTGGGAGACGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058058808_1058058816 11 Left 1058058808 9:100474116-100474138 CCCAGGCAGGGATCTGTGTGTGT 0: 1
1: 0
2: 4
3: 43
4: 411
Right 1058058816 9:100474150-100474172 GCGGTGGGTGGGAGACGGCGAGG No data
1058058809_1058058816 10 Left 1058058809 9:100474117-100474139 CCAGGCAGGGATCTGTGTGTGTG 0: 1
1: 0
2: 7
3: 76
4: 546
Right 1058058816 9:100474150-100474172 GCGGTGGGTGGGAGACGGCGAGG No data
1058058807_1058058816 12 Left 1058058807 9:100474115-100474137 CCCCAGGCAGGGATCTGTGTGTG 0: 1
1: 0
2: 0
3: 36
4: 385
Right 1058058816 9:100474150-100474172 GCGGTGGGTGGGAGACGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058058816 Original CRISPR GCGGTGGGTGGGAGACGGCG AGG Intronic
No off target data available for this crispr