ID: 1058069270

View in Genome Browser
Species Human (GRCh38)
Location 9:100585179-100585201
Sequence CTCTACCAATGTCTTGATTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058069270_1058069273 -10 Left 1058069270 9:100585179-100585201 CCGGAATCAAGACATTGGTAGAG 0: 1
1: 0
2: 1
3: 21
4: 206
Right 1058069273 9:100585192-100585214 ATTGGTAGAGGGAATGAAGAAGG No data
1058069270_1058069274 -7 Left 1058069270 9:100585179-100585201 CCGGAATCAAGACATTGGTAGAG 0: 1
1: 0
2: 1
3: 21
4: 206
Right 1058069274 9:100585195-100585217 GGTAGAGGGAATGAAGAAGGAGG No data
1058069270_1058069276 -3 Left 1058069270 9:100585179-100585201 CCGGAATCAAGACATTGGTAGAG 0: 1
1: 0
2: 1
3: 21
4: 206
Right 1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG No data
1058069270_1058069275 -4 Left 1058069270 9:100585179-100585201 CCGGAATCAAGACATTGGTAGAG 0: 1
1: 0
2: 1
3: 21
4: 206
Right 1058069275 9:100585198-100585220 AGAGGGAATGAAGAAGGAGGAGG No data
1058069270_1058069277 15 Left 1058069270 9:100585179-100585201 CCGGAATCAAGACATTGGTAGAG 0: 1
1: 0
2: 1
3: 21
4: 206
Right 1058069277 9:100585217-100585239 GAGGGAACAGATAAGTTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058069270 Original CRISPR CTCTACCAATGTCTTGATTC CGG (reversed) Intronic
900779421 1:4608053-4608075 CCCTGCCGATGCCTTGATTCTGG - Intergenic
900851386 1:5145777-5145799 CCCCACCAATATCTTGATTTTGG + Intergenic
902133744 1:14286161-14286183 CCCTACCAATGCCTTGATCTTGG - Intergenic
903733151 1:25512817-25512839 ATCTACCAATGCCTTGATCTTGG + Intergenic
904421445 1:30397186-30397208 CCCTACCAATGCCTTGGTTTTGG + Intergenic
905844468 1:41216894-41216916 CTCTACCAACACCTTGATTTTGG - Intronic
909607398 1:77520949-77520971 CTCTACCAATTTCCAGACTCTGG + Intronic
909972286 1:82005020-82005042 ATCTACAAATGTCTTGAATATGG - Intergenic
912162158 1:106998399-106998421 CTCTACCAATTGCATGAGTCAGG + Intergenic
917775348 1:178328018-178328040 CTCTGCCTATGCCTTGATTTTGG + Intronic
918254525 1:182737019-182737041 CCCTGCCAATGCCTTGATTTTGG - Intergenic
918727525 1:187944351-187944373 CCCTACCAAAATCTTGATTTTGG + Intergenic
919837423 1:201584749-201584771 CTCCACCAAGGCCTGGATTCTGG + Intergenic
923217206 1:231859360-231859382 ATCTACCACTGCCTCGATTCTGG - Intronic
924622298 1:245672694-245672716 CTCTACCAAAGTCTGGAGGCTGG + Intronic
924631430 1:245744414-245744436 CTGTACCCATCCCTTGATTCTGG + Intergenic
924824417 1:247524319-247524341 CTCTTCCAAAGCCTTGATACTGG + Intronic
1065067038 10:21980019-21980041 CTCTGTTAATGTTTTGATTCTGG - Intronic
1068579719 10:58725402-58725424 CTCTACCTCTGTCTTGACTGTGG + Intronic
1068731290 10:60361107-60361129 TTGATCCAATGTCTTGATTCTGG - Intronic
1068747525 10:60551046-60551068 TTTTACCAATGTCATGATACTGG + Intronic
1072415935 10:95246859-95246881 CACTACCAAGGTATTGTTTCTGG + Intronic
1074932305 10:118141064-118141086 CTCTACTGCTGTCTTAATTCAGG + Intergenic
1075263955 10:120985012-120985034 CCCTGCCAATGCCTTGATTTTGG - Intergenic
1075820734 10:125306776-125306798 CTCTCCCCATGTCTTCATACGGG - Intergenic
1076049395 10:127320618-127320640 CTCTCCCCATGTCTAGTTTCAGG - Intronic
1077564773 11:3290657-3290679 CTCCACCCATGGCTTGATGCAGG + Intergenic
1077570663 11:3336474-3336496 CTCCACCCATGGCTTGATGCAGG + Intergenic
1079064801 11:17280325-17280347 CTATACTAATGTCTTGATCAGGG + Intronic
1079464903 11:20720619-20720641 CTCCACCAATACCTTGATTTTGG - Intronic
1079810486 11:24993365-24993387 CTCTATCAATGTCATTATTTGGG + Intronic
1081315818 11:41628536-41628558 CTCTATCAATGTCGTGATTTTGG - Intergenic
1081369684 11:42284555-42284577 CTCTGCCAACACCTTGATTCTGG - Intergenic
1082194074 11:49280727-49280749 CCCTCCCAATGTCTTGATTTTGG - Intergenic
1082251684 11:49989021-49989043 ATCTGCCAATGCCTTGATCCTGG + Intergenic
1084531015 11:69727771-69727793 CTCTCTCAAAGTCTTGACTCTGG - Intergenic
1085765519 11:79278541-79278563 CTCTTCCGATGTCTGGAGTCTGG - Intronic
1086672079 11:89560314-89560336 CCCTCCCAATATCTTGATTTTGG + Intergenic
1088009628 11:104984352-104984374 ATCTTCCAATGCCTTGATCCTGG + Intergenic
1088161651 11:106878861-106878883 CTCTGCCAATTCCTTAATTCTGG + Intronic
1088324204 11:108585519-108585541 CTCTACCAGTGCCTTGATCTTGG + Intronic
1088441348 11:109874443-109874465 CAATACCAATTTCTGGATTCTGG - Intergenic
1088605990 11:111532616-111532638 CCCTACCAATACCTTGATTTCGG + Intronic
1089949853 11:122515537-122515559 GTTTACCACTGTCTTCATTCAGG + Intergenic
1091017575 11:132066568-132066590 CTCTGCCAATGTCTTGATGTGGG - Intronic
1091187160 11:133657158-133657180 CTCTGCCAATGCCTTGATCTTGG + Intergenic
1092516805 12:9223298-9223320 CCCTACCAATACCTTGATTTTGG - Intergenic
1093248960 12:16776329-16776351 CTATAACACTGTCTTGATTATGG - Intergenic
1093537930 12:20244975-20244997 CTCTACCAATGCCTTGCTCCTGG - Intergenic
1095341457 12:41094035-41094057 CCCTGACAATGTCTTGATTCTGG - Intergenic
1095384001 12:41628721-41628743 ATCTGCCAATACCTTGATTCTGG + Intergenic
1098430061 12:70409256-70409278 CTCCACCACTGCCTGGATTCAGG + Intronic
1099147782 12:79068679-79068701 CTGTACCAATGTACTGATTATGG - Intronic
1100366621 12:93927175-93927197 CTCTGCCAATGTCTTGATCTTGG + Intergenic
1100600326 12:96107357-96107379 CTCCACCAAAATCTTGAATCAGG - Intergenic
1100857956 12:98775068-98775090 CTCTGCCATTATCTTGATTGGGG + Intronic
1101413474 12:104488882-104488904 ACCTACCAATATCTTGATCCTGG - Intronic
1101843710 12:108345390-108345412 CTATTACAGTGTCTTGATTCTGG + Intergenic
1102560157 12:113756184-113756206 CCCTACCGATGCCTTGATTTGGG + Intergenic
1106922613 13:34579710-34579732 ACCTACCAATGTCTTGTTTTCGG + Intergenic
1106989232 13:35396968-35396990 CACTACCAGTGTCTTCATCCTGG + Intronic
1107809706 13:44188612-44188634 CACTACCAATGTGTTGAGTCAGG + Intergenic
1111286035 13:86093051-86093073 CTCTTACAATGTCTTGATTGAGG - Intergenic
1111318937 13:86598448-86598470 CTATGACAATGTCTTCATTCTGG + Intergenic
1111424902 13:88067904-88067926 TTATTCCACTGTCTTGATTCAGG - Intergenic
1112967704 13:105218474-105218496 CTCTGCCAACATCTTGATTTTGG - Intergenic
1115976774 14:39005376-39005398 CTCCACCAAGGCCTGGATTCTGG + Intergenic
1116204699 14:41848779-41848801 CTCTGCCAGTGTCTTGGTTGAGG - Intronic
1117782765 14:59251665-59251687 CTCTAACACTGTCCTGTTTCAGG - Intronic
1120421571 14:84292629-84292651 CTCTGCCTGTGTCTTCATTCTGG + Intergenic
1120497357 14:85253618-85253640 ATCTGCCAATGTCTTGATCATGG - Intergenic
1120771746 14:88386561-88386583 CTCTACTGATTTCTTGAGTCAGG + Intronic
1120858554 14:89234283-89234305 CCCTGCCAATGCCTTGATTTTGG - Intronic
1121633148 14:95435963-95435985 CACTACCATTGTCTTAATTTAGG - Intronic
1124857727 15:33406982-33407004 TCCTGCCAATGCCTTGATTCTGG - Intronic
1125153852 15:36563898-36563920 ATCTACCAGTGCCTTGATTCTGG + Intergenic
1126531487 15:49715664-49715686 CTCTTCTCATGTCTTGATTCAGG - Intergenic
1127112798 15:55692487-55692509 CTCTTCCTATGTTCTGATTCAGG - Intronic
1129943604 15:79519989-79520011 CTCTGCCATTGTCTTGAGTGGGG + Intergenic
1135209194 16:20509670-20509692 CTCTGCCAGTATCTTGATTGTGG - Intergenic
1135981366 16:27150086-27150108 CTCTACCATTGTCTTAGTTCAGG + Intergenic
1137838525 16:51618288-51618310 ATCTGCCAGTTTCTTGATTCTGG + Intergenic
1139033761 16:62917898-62917920 CTCTGCCTTTGACTTGATTCTGG - Intergenic
1140128883 16:72140353-72140375 CTCTCCCCATGTCTTGATTGAGG + Intronic
1140144351 16:72291189-72291211 CTCTGCCAACACCTTGATTCTGG - Intergenic
1143274772 17:5702117-5702139 CTCTACCATTGTCTTAATGGTGG - Intergenic
1149628727 17:58101690-58101712 ATTTGCCAATGTCTTGATTTTGG - Intergenic
1150889057 17:69123738-69123760 CTGTACTAATGTCTTGATCAGGG - Intronic
1152314275 17:79571258-79571280 CTCTGCCATTTTCTTGATTTGGG - Intergenic
1153424795 18:4950650-4950672 ATCTGCCAGTGTCTTGATCCTGG + Intergenic
1155797997 18:30064702-30064724 CTCTACCAATCTATTGTCTCAGG + Intergenic
1155835656 18:30580745-30580767 CCCCACCAACGTCTTGAATCAGG + Intergenic
1156526422 18:37771878-37771900 CCCTGACAATGTCTTCATTCTGG + Intergenic
1157141573 18:45113010-45113032 CTCTTCCCATGTTTTGGTTCAGG + Intergenic
1157663659 18:49467423-49467445 CTCTGACAATGCCTTGATTTTGG - Intergenic
1158663667 18:59412923-59412945 CTCTGCCAACGCCTTGATTTTGG - Intergenic
1158756182 18:60328336-60328358 CTCTGCCAAAGTCTTGATTTAGG - Intergenic
1161694584 19:5759009-5759031 CTCTCCCAATGTCCTGAGTTGGG + Intronic
1163670489 19:18625061-18625083 CTCTGCCCATGTCTTATTTCTGG - Intergenic
1165003043 19:32780627-32780649 CTCTCCCCACGTCATGATTCTGG + Intronic
1165451917 19:35888743-35888765 CTCTTCCAAAATCTTGACTCTGG - Intronic
926870594 2:17411339-17411361 CTCTGCCAATGTGTTGGTGCAGG - Intergenic
927033288 2:19144920-19144942 CTCTATCTAGGTATTGATTCAGG - Intergenic
929090604 2:38213513-38213535 CTCTATCAATGTCAATATTCTGG + Intergenic
929379941 2:41337624-41337646 CTCTGCCAATACCTTGATTTTGG + Intergenic
931945796 2:67305792-67305814 TTGTCCCAATGTCTTAATTCAGG - Intergenic
933184810 2:79267306-79267328 CTCTGCCAGTGTCTTTATTTTGG - Intronic
933781065 2:85801632-85801654 CTCTGCCAGTGTCTTGATCTTGG + Intergenic
934638737 2:96013297-96013319 CTCTACCCTTGTCTAGTTTCTGG - Intergenic
934794914 2:97092115-97092137 CTCTACCCTTGTCTAGTTTCTGG + Intronic
935418017 2:102838820-102838842 CTCTGCCAATGGCTTGGTTGAGG - Intronic
937498400 2:122450295-122450317 CTTCACCATTGTCTTGATTTTGG + Intergenic
938366840 2:130741240-130741262 CTCTCCCAATCTCTTATTTCTGG - Intergenic
938774554 2:134530089-134530111 CTCTACATATCTCTTGCTTCTGG - Intronic
940349022 2:152660482-152660504 GTCTAACAATGTCTTGTTTGAGG - Intronic
941118329 2:161498109-161498131 CTGTACCACTGTTTTGATTATGG + Intronic
943289692 2:186053385-186053407 CTCCACCAATTTCATGATCCTGG + Intergenic
943692999 2:190888177-190888199 CTCTTCTAATATCCTGATTCTGG + Intronic
946677158 2:222172413-222172435 ATCTACCAATGCCTTGATCTTGG - Intergenic
1169510678 20:6260817-6260839 CTCTGCCAATGCCTTGGTTCAGG - Intergenic
1169804677 20:9547251-9547273 CACTACCAAAATCTTGATTTTGG + Intronic
1172035199 20:32005679-32005701 CTCTGCCAATGCCTTGATCTTGG - Intergenic
1172361521 20:34316085-34316107 CCCTGCCAATGCCTTGATTTTGG + Intergenic
1172468456 20:35174316-35174338 CTCTTCCACTGCCCTGATTCAGG - Intronic
1177629928 21:23713478-23713500 CTCTTCCAGTGTCTTGAGCCTGG + Intergenic
1182997196 22:34824997-34825019 CTCTCCCATTGTCTGGATCCTGG - Intergenic
1184017007 22:41793894-41793916 TTCTACCAATGTCTGGGCTCCGG - Exonic
950937648 3:16857477-16857499 CTCTATCAATGTTTCTATTCTGG + Intronic
952262882 3:31757481-31757503 CTCTACCAATGACTTGATTTTGG + Intronic
953729003 3:45429256-45429278 CTCTACCAACACCTTGATTTTGG - Intronic
957194030 3:77044915-77044937 CTATGCCAATGTATTGATTTAGG - Intronic
957368071 3:79252507-79252529 CCCTGCCAATGCCTTGATTTTGG + Intronic
957569878 3:81932978-81933000 CTGTACCAATGTCTTCTTTAAGG - Intergenic
958886352 3:99732056-99732078 CCCTGCCAATATCTTGATTTCGG + Intronic
959120647 3:102228254-102228276 ACATACCCATGTCTTGATTCGGG - Intronic
961008501 3:123420819-123420841 CTCTGCCAACGTTTTGATTTTGG - Intronic
962301247 3:134244998-134245020 ATCTACCAAAGCCTTGATCCTGG + Intronic
962429692 3:135307692-135307714 TTCTACCAAGGTCTGGATACTGG - Intergenic
962714880 3:138117373-138117395 ATCTGCCAATGTCTTGATTTTGG - Intergenic
963635625 3:147791997-147792019 GTCTACCAGTGTCTTGACTTTGG - Intergenic
964576772 3:158179306-158179328 CTGTATCAATGTCTACATTCTGG - Intronic
965003754 3:162989441-162989463 TCCTACCAATGCCTTGATTTTGG - Intergenic
965461557 3:168971005-168971027 CATTACCACTGTCTTGGTTCAGG - Intergenic
966302072 3:178490267-178490289 CTCTACCAACATCTTGATTTTGG - Intronic
967104326 3:186243110-186243132 ATCTACCAATGTCAGGTTTCTGG - Intronic
967760594 3:193221033-193221055 CTCTACAGATTTCTTCATTCTGG + Intergenic
970231773 4:13918096-13918118 TTTTACCCATGTCTTGAATCTGG + Intergenic
970239114 4:13989608-13989630 CCCTGCCAATGCCTTGATTTAGG - Intergenic
970543155 4:17099767-17099789 ATCCACCAATGTCTTGATCTTGG - Intergenic
970724302 4:19026010-19026032 CTTTTCCAATGTCTTGATCCTGG - Intergenic
971254830 4:25004725-25004747 ATCTGCCAATGTCTTGATCTTGG + Intronic
972466189 4:39359201-39359223 CACTGCCACTGCCTTGATTCAGG + Intronic
972842261 4:42945170-42945192 ATCTACTAATGTCTTGCTTTTGG + Intronic
975394966 4:73864088-73864110 CTCTTCCAATGTAATGACTCTGG - Intergenic
975405731 4:73987305-73987327 CTGTACAATTTTCTTGATTCTGG + Exonic
975410509 4:74043322-74043344 CTCTTCCAATGTAATGACTCTGG + Intergenic
976625157 4:87172358-87172380 CTAGCCCAATCTCTTGATTCTGG + Intronic
978187362 4:105872250-105872272 ATCTACCAGTGCCTTGATTTTGG + Intronic
980521133 4:133935766-133935788 CTGTATCAATGTCATTATTCTGG - Intergenic
981167410 4:141577825-141577847 CTCTACTGCTGTCATGATTCAGG + Intergenic
981312116 4:143307540-143307562 CCCTGCCAATGCCTTGATTTCGG + Intergenic
981604098 4:146523908-146523930 CTCTGCCAAAATCTTGATTTTGG - Intergenic
982262381 4:153506141-153506163 CTCTTCCAATATGTAGATTCAGG - Intronic
982775954 4:159441554-159441576 CTCTACCAACATCTTGATCTTGG - Intergenic
986187890 5:5462232-5462254 CTCTCACAATGTCTTGGTTTTGG - Exonic
987819813 5:22948238-22948260 CTAAACCAATATCTTGACTCTGG + Intergenic
987844791 5:23269296-23269318 CACTGCCAATGTCTTGATTTTGG + Intergenic
988806023 5:34741577-34741599 CTCAGCCAAGCTCTTGATTCTGG - Intronic
992413577 5:76531891-76531913 ATCTACCAATGTCTTGATCTTGG - Intronic
994114274 5:96044435-96044457 ATCTGCCAGTGTCTTGATTTTGG + Intergenic
994204390 5:97017822-97017844 CTCTGCCAATACCTTGATTTTGG - Intronic
995158559 5:108945916-108945938 CTCAACAAATGTTTTGATTTGGG - Intronic
1004618756 6:17314930-17314952 GTCTGCCAATGTCTTGATCTGGG + Intergenic
1005199374 6:23325827-23325849 CCCAGCCAATGTCTTGATTTCGG + Intergenic
1006955905 6:37871508-37871530 ATCCACCAATATCTTTATTCTGG - Intronic
1007268783 6:40619669-40619691 CTCTGCCAATACCTTGATTTTGG + Intergenic
1010142569 6:72627967-72627989 CTCTACCAATGTCATTATAATGG + Intronic
1010427950 6:75747606-75747628 CACTACCACTATCTTGTTTCAGG - Intergenic
1010875917 6:81105515-81105537 CCCTACCAACACCTTGATTCAGG - Intergenic
1013194497 6:107833349-107833371 TCCTACCAATTTCCTGATTCAGG - Intergenic
1013264863 6:108486095-108486117 CTTTACCAATCTCTTCATACAGG - Intronic
1016753436 6:147657652-147657674 ATCTGCCAATGGCTTGATCCTGG - Intronic
1020464226 7:8458358-8458380 CTCTATCAATGTGTTAATTATGG - Intronic
1021678044 7:23100675-23100697 CTCTACCAATCGCATGAGTCTGG + Intergenic
1023415493 7:39928306-39928328 CTCTGCCAACATTTTGATTCTGG - Intergenic
1023624306 7:42100908-42100930 CCCTACCAATACCTTGATTTTGG + Intronic
1025009508 7:55384635-55384657 CTTTACCTTTGTCTTGATTTGGG - Intronic
1026119295 7:67522742-67522764 CTATGCCATTGTCTGGATTCCGG + Intergenic
1027570001 7:79853842-79853864 ATCTGCCAGTGTCTTGATTTTGG + Intergenic
1027730621 7:81867604-81867626 CTCTACCAACATCTTAATTTTGG - Intergenic
1027754048 7:82187843-82187865 CTCTGCCAATGCCTTGATCTTGG - Intronic
1027858029 7:83537927-83537949 CTCTATCAATTTCCTTATTCTGG + Intronic
1028808086 7:95052344-95052366 CTCTATCACAGTCTTGCTTCAGG - Intronic
1031083827 7:117282867-117282889 CACTACCACTGTCTTAATCCAGG - Intronic
1031399007 7:121309270-121309292 CCCTCCCAATATCTTGATTTTGG - Intergenic
1034823081 7:154234931-154234953 CTCTTCCAAAATCTTGATACCGG + Intronic
1037840678 8:22243322-22243344 CTGTACCAATGTCAATATTCTGG + Intergenic
1039328236 8:36508612-36508634 CCCTGCCAATGCCTTGATTTTGG + Intergenic
1041846388 8:62334267-62334289 CTCTGCCGACATCTTGATTCTGG - Intronic
1043566220 8:81551381-81551403 CTCTACCAGTGTTTTGACTCTGG + Intergenic
1044662398 8:94604455-94604477 ATCTACCAGTGTCTTGATCTTGG - Intergenic
1045129934 8:99139768-99139790 TTCTACAAATTTCTTGTTTCAGG - Intronic
1047033337 8:120907791-120907813 CCCTGCCAATATCTTGATTTTGG + Intergenic
1047832209 8:128647207-128647229 CTCTACCAATCTCCTGCTTAAGG + Intergenic
1048109073 8:131447042-131447064 CTCTATCAATGTCAATATTCTGG - Intergenic
1050327817 9:4514863-4514885 CTCTGACACTGTCTTGGTTCAGG - Intronic
1050997267 9:12236114-12236136 CTCTACAATGGTCTTGATTTGGG - Intergenic
1051570409 9:18550623-18550645 CCCTTCCAATGCCTTGATTTTGG + Intronic
1051571642 9:18565182-18565204 CTGTTCCAATGTCTTCATTCAGG - Intronic
1055726635 9:79237383-79237405 ATCTACCAGTGTCTTGATCTTGG - Intergenic
1056456244 9:86763761-86763783 CCCTGCCAATGCCTTGATTTCGG + Intergenic
1056926948 9:90843428-90843450 CTCTAACATTGTCTGGACTCAGG + Intronic
1058069270 9:100585179-100585201 CTCTACCAATGTCTTGATTCCGG - Intronic
1058274056 9:103017790-103017812 CGCTGCCAATATCTTGATTGTGG - Intronic
1059712712 9:116884396-116884418 CTCTACTGATGTCTTAATTTTGG - Intronic
1060032653 9:120228708-120228730 CTTAATTAATGTCTTGATTCTGG + Intergenic
1186408761 X:9327198-9327220 CTCTACCAGTGCCTTGATCTTGG + Intergenic
1186875349 X:13811058-13811080 CTTTTAAAATGTCTTGATTCTGG + Intronic
1187580094 X:20598122-20598144 CTAATCCAAAGTCTTGATTCAGG - Intergenic
1188159900 X:26786263-26786285 CTCTAACAATGAAATGATTCAGG - Intergenic
1189505022 X:41604540-41604562 CCCTGCCAATGCCTTGATTTAGG + Intronic
1190152872 X:47962830-47962852 CTCTCCCAATCCCTTCATTCTGG + Intronic
1190990005 X:55536928-55536950 CACTCTCAATGTCTTGTTTCTGG + Intergenic
1192374184 X:70542320-70542342 ATCTGCCAGTGTCTTGATTTTGG + Intronic
1193660440 X:84250432-84250454 GTCTTTCACTGTCTTGATTCAGG + Intergenic
1194924830 X:99811690-99811712 CTTTACCATTGTGATGATTCTGG + Intergenic
1195864320 X:109412939-109412961 CTCTTCCAATATCATGACTCAGG - Intronic
1197970509 X:132110327-132110349 CACTACCACTGTCTTAATCCAGG - Intronic
1201396773 Y:13556926-13556948 CTCTTCAAATATCTTGTTTCTGG + Intergenic