ID: 1058069276

View in Genome Browser
Species Human (GRCh38)
Location 9:100585199-100585221
Sequence GAGGGAATGAAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058069270_1058069276 -3 Left 1058069270 9:100585179-100585201 CCGGAATCAAGACATTGGTAGAG 0: 1
1: 0
2: 1
3: 21
4: 206
Right 1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058069276 Original CRISPR GAGGGAATGAAGAAGGAGGA GGG Intronic
No off target data available for this crispr