ID: 1058069863

View in Genome Browser
Species Human (GRCh38)
Location 9:100591038-100591060
Sequence GCAGCTAGAGAGATTGTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058069861_1058069863 11 Left 1058069861 9:100591004-100591026 CCATTTGAGTCAAGAATAGAATT No data
Right 1058069863 9:100591038-100591060 GCAGCTAGAGAGATTGTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058069863 Original CRISPR GCAGCTAGAGAGATTGTATG AGG Intergenic
No off target data available for this crispr