ID: 1058069965

View in Genome Browser
Species Human (GRCh38)
Location 9:100591910-100591932
Sequence TCTAATATGACAGACATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058069965_1058069971 9 Left 1058069965 9:100591910-100591932 CCCTCCATGTCTGTCATATTAGA No data
Right 1058069971 9:100591942-100591964 TGGCATCAAAAATGTATCAGGGG No data
1058069965_1058069973 19 Left 1058069965 9:100591910-100591932 CCCTCCATGTCTGTCATATTAGA No data
Right 1058069973 9:100591952-100591974 AATGTATCAGGGGTTCAAGGTGG No data
1058069965_1058069970 8 Left 1058069965 9:100591910-100591932 CCCTCCATGTCTGTCATATTAGA No data
Right 1058069970 9:100591941-100591963 ATGGCATCAAAAATGTATCAGGG No data
1058069965_1058069969 7 Left 1058069965 9:100591910-100591932 CCCTCCATGTCTGTCATATTAGA No data
Right 1058069969 9:100591940-100591962 CATGGCATCAAAAATGTATCAGG No data
1058069965_1058069974 20 Left 1058069965 9:100591910-100591932 CCCTCCATGTCTGTCATATTAGA No data
Right 1058069974 9:100591953-100591975 ATGTATCAGGGGTTCAAGGTGGG No data
1058069965_1058069972 16 Left 1058069965 9:100591910-100591932 CCCTCCATGTCTGTCATATTAGA No data
Right 1058069972 9:100591949-100591971 AAAAATGTATCAGGGGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058069965 Original CRISPR TCTAATATGACAGACATGGA GGG (reversed) Intergenic
No off target data available for this crispr