ID: 1058070920

View in Genome Browser
Species Human (GRCh38)
Location 9:100599714-100599736
Sequence GCTGAACCCGCAACCAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058070920_1058070922 -8 Left 1058070920 9:100599714-100599736 CCTCCTTTGGTTGCGGGTTCAGC No data
Right 1058070922 9:100599729-100599751 GGTTCAGCAGATCTCTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058070920 Original CRISPR GCTGAACCCGCAACCAAAGG AGG (reversed) Intergenic
No off target data available for this crispr