ID: 1058076887

View in Genome Browser
Species Human (GRCh38)
Location 9:100660519-100660541
Sequence AGACATGGAGAGGACAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058076887_1058076895 25 Left 1058076887 9:100660519-100660541 CCTTCCCTGTCCTCTCCATGTCT No data
Right 1058076895 9:100660567-100660589 CTTTGAGAAGCACATTCAGGAGG No data
1058076887_1058076894 22 Left 1058076887 9:100660519-100660541 CCTTCCCTGTCCTCTCCATGTCT No data
Right 1058076894 9:100660564-100660586 GTACTTTGAGAAGCACATTCAGG No data
1058076887_1058076896 26 Left 1058076887 9:100660519-100660541 CCTTCCCTGTCCTCTCCATGTCT No data
Right 1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG No data
1058076887_1058076891 -10 Left 1058076887 9:100660519-100660541 CCTTCCCTGTCCTCTCCATGTCT No data
Right 1058076891 9:100660532-100660554 CTCCATGTCTTCCACAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058076887 Original CRISPR AGACATGGAGAGGACAGGGA AGG (reversed) Intergenic
No off target data available for this crispr