ID: 1058076888

View in Genome Browser
Species Human (GRCh38)
Location 9:100660523-100660545
Sequence TGGAAGACATGGAGAGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058076888_1058076897 30 Left 1058076888 9:100660523-100660545 CCCTGTCCTCTCCATGTCTTCCA No data
Right 1058076897 9:100660576-100660598 GCACATTCAGGAGGGCTGTCTGG No data
1058076888_1058076894 18 Left 1058076888 9:100660523-100660545 CCCTGTCCTCTCCATGTCTTCCA No data
Right 1058076894 9:100660564-100660586 GTACTTTGAGAAGCACATTCAGG No data
1058076888_1058076896 22 Left 1058076888 9:100660523-100660545 CCCTGTCCTCTCCATGTCTTCCA No data
Right 1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG No data
1058076888_1058076895 21 Left 1058076888 9:100660523-100660545 CCCTGTCCTCTCCATGTCTTCCA No data
Right 1058076895 9:100660567-100660589 CTTTGAGAAGCACATTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058076888 Original CRISPR TGGAAGACATGGAGAGGACA GGG (reversed) Intergenic
No off target data available for this crispr