ID: 1058076889

View in Genome Browser
Species Human (GRCh38)
Location 9:100660524-100660546
Sequence GTGGAAGACATGGAGAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058076889_1058076894 17 Left 1058076889 9:100660524-100660546 CCTGTCCTCTCCATGTCTTCCAC No data
Right 1058076894 9:100660564-100660586 GTACTTTGAGAAGCACATTCAGG No data
1058076889_1058076895 20 Left 1058076889 9:100660524-100660546 CCTGTCCTCTCCATGTCTTCCAC No data
Right 1058076895 9:100660567-100660589 CTTTGAGAAGCACATTCAGGAGG No data
1058076889_1058076896 21 Left 1058076889 9:100660524-100660546 CCTGTCCTCTCCATGTCTTCCAC No data
Right 1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG No data
1058076889_1058076897 29 Left 1058076889 9:100660524-100660546 CCTGTCCTCTCCATGTCTTCCAC No data
Right 1058076897 9:100660576-100660598 GCACATTCAGGAGGGCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058076889 Original CRISPR GTGGAAGACATGGAGAGGAC AGG (reversed) Intergenic
No off target data available for this crispr