ID: 1058076892

View in Genome Browser
Species Human (GRCh38)
Location 9:100660534-100660556
Sequence CACCTTAGCTGTGGAAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058076892_1058076894 7 Left 1058076892 9:100660534-100660556 CCATGTCTTCCACAGCTAAGGTG No data
Right 1058076894 9:100660564-100660586 GTACTTTGAGAAGCACATTCAGG No data
1058076892_1058076896 11 Left 1058076892 9:100660534-100660556 CCATGTCTTCCACAGCTAAGGTG No data
Right 1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG No data
1058076892_1058076895 10 Left 1058076892 9:100660534-100660556 CCATGTCTTCCACAGCTAAGGTG No data
Right 1058076895 9:100660567-100660589 CTTTGAGAAGCACATTCAGGAGG No data
1058076892_1058076898 25 Left 1058076892 9:100660534-100660556 CCATGTCTTCCACAGCTAAGGTG No data
Right 1058076898 9:100660582-100660604 TCAGGAGGGCTGTCTGGTATAGG No data
1058076892_1058076897 19 Left 1058076892 9:100660534-100660556 CCATGTCTTCCACAGCTAAGGTG No data
Right 1058076897 9:100660576-100660598 GCACATTCAGGAGGGCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058076892 Original CRISPR CACCTTAGCTGTGGAAGACA TGG (reversed) Intergenic
No off target data available for this crispr