ID: 1058076893

View in Genome Browser
Species Human (GRCh38)
Location 9:100660543-100660565
Sequence ACATGCTGTCACCTTAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058076893_1058076897 10 Left 1058076893 9:100660543-100660565 CCACAGCTAAGGTGACAGCATGT No data
Right 1058076897 9:100660576-100660598 GCACATTCAGGAGGGCTGTCTGG No data
1058076893_1058076900 28 Left 1058076893 9:100660543-100660565 CCACAGCTAAGGTGACAGCATGT No data
Right 1058076900 9:100660594-100660616 TCTGGTATAGGTGAATCACAGGG No data
1058076893_1058076899 27 Left 1058076893 9:100660543-100660565 CCACAGCTAAGGTGACAGCATGT No data
Right 1058076899 9:100660593-100660615 GTCTGGTATAGGTGAATCACAGG No data
1058076893_1058076894 -2 Left 1058076893 9:100660543-100660565 CCACAGCTAAGGTGACAGCATGT No data
Right 1058076894 9:100660564-100660586 GTACTTTGAGAAGCACATTCAGG No data
1058076893_1058076896 2 Left 1058076893 9:100660543-100660565 CCACAGCTAAGGTGACAGCATGT No data
Right 1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG No data
1058076893_1058076895 1 Left 1058076893 9:100660543-100660565 CCACAGCTAAGGTGACAGCATGT No data
Right 1058076895 9:100660567-100660589 CTTTGAGAAGCACATTCAGGAGG No data
1058076893_1058076898 16 Left 1058076893 9:100660543-100660565 CCACAGCTAAGGTGACAGCATGT No data
Right 1058076898 9:100660582-100660604 TCAGGAGGGCTGTCTGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058076893 Original CRISPR ACATGCTGTCACCTTAGCTG TGG (reversed) Intergenic
No off target data available for this crispr