ID: 1058076896

View in Genome Browser
Species Human (GRCh38)
Location 9:100660568-100660590
Sequence TTTGAGAAGCACATTCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058076893_1058076896 2 Left 1058076893 9:100660543-100660565 CCACAGCTAAGGTGACAGCATGT No data
Right 1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG No data
1058076888_1058076896 22 Left 1058076888 9:100660523-100660545 CCCTGTCCTCTCCATGTCTTCCA No data
Right 1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG No data
1058076892_1058076896 11 Left 1058076892 9:100660534-100660556 CCATGTCTTCCACAGCTAAGGTG No data
Right 1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG No data
1058076890_1058076896 16 Left 1058076890 9:100660529-100660551 CCTCTCCATGTCTTCCACAGCTA No data
Right 1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG No data
1058076889_1058076896 21 Left 1058076889 9:100660524-100660546 CCTGTCCTCTCCATGTCTTCCAC No data
Right 1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG No data
1058076887_1058076896 26 Left 1058076887 9:100660519-100660541 CCTTCCCTGTCCTCTCCATGTCT No data
Right 1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058076896 Original CRISPR TTTGAGAAGCACATTCAGGA GGG Intergenic
No off target data available for this crispr