ID: 1058077111

View in Genome Browser
Species Human (GRCh38)
Location 9:100662357-100662379
Sequence TGCTCTGGCAATACTGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058077109_1058077111 -4 Left 1058077109 9:100662338-100662360 CCAAGCTGGTCATAATTCATGCT No data
Right 1058077111 9:100662357-100662379 TGCTCTGGCAATACTGTGCCTGG No data
1058077107_1058077111 16 Left 1058077107 9:100662318-100662340 CCTGGAAAGACACTCGTTGGCCA No data
Right 1058077111 9:100662357-100662379 TGCTCTGGCAATACTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058077111 Original CRISPR TGCTCTGGCAATACTGTGCC TGG Intergenic
No off target data available for this crispr