ID: 1058078398

View in Genome Browser
Species Human (GRCh38)
Location 9:100674205-100674227
Sequence CCCCTCAGCACATATACATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058078398_1058078400 -10 Left 1058078398 9:100674205-100674227 CCTAATGTATATGTGCTGAGGGG No data
Right 1058078400 9:100674218-100674240 TGCTGAGGGGTGAAAACAGATGG No data
1058078398_1058078408 12 Left 1058078398 9:100674205-100674227 CCTAATGTATATGTGCTGAGGGG No data
Right 1058078408 9:100674240-100674262 GAAAGGGGCGGCAGGTTCTGGGG No data
1058078398_1058078401 -5 Left 1058078398 9:100674205-100674227 CCTAATGTATATGTGCTGAGGGG No data
Right 1058078401 9:100674223-100674245 AGGGGTGAAAACAGATGGAAAGG No data
1058078398_1058078403 -3 Left 1058078398 9:100674205-100674227 CCTAATGTATATGTGCTGAGGGG No data
Right 1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG No data
1058078398_1058078402 -4 Left 1058078398 9:100674205-100674227 CCTAATGTATATGTGCTGAGGGG No data
Right 1058078402 9:100674224-100674246 GGGGTGAAAACAGATGGAAAGGG No data
1058078398_1058078404 0 Left 1058078398 9:100674205-100674227 CCTAATGTATATGTGCTGAGGGG No data
Right 1058078404 9:100674228-100674250 TGAAAACAGATGGAAAGGGGCGG No data
1058078398_1058078405 4 Left 1058078398 9:100674205-100674227 CCTAATGTATATGTGCTGAGGGG No data
Right 1058078405 9:100674232-100674254 AACAGATGGAAAGGGGCGGCAGG No data
1058078398_1058078407 11 Left 1058078398 9:100674205-100674227 CCTAATGTATATGTGCTGAGGGG No data
Right 1058078407 9:100674239-100674261 GGAAAGGGGCGGCAGGTTCTGGG No data
1058078398_1058078406 10 Left 1058078398 9:100674205-100674227 CCTAATGTATATGTGCTGAGGGG No data
Right 1058078406 9:100674238-100674260 TGGAAAGGGGCGGCAGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058078398 Original CRISPR CCCCTCAGCACATATACATT AGG (reversed) Intergenic
No off target data available for this crispr