ID: 1058078403

View in Genome Browser
Species Human (GRCh38)
Location 9:100674225-100674247
Sequence GGGTGAAAACAGATGGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058078398_1058078403 -3 Left 1058078398 9:100674205-100674227 CCTAATGTATATGTGCTGAGGGG No data
Right 1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058078403 Original CRISPR GGGTGAAAACAGATGGAAAG GGG Intergenic
No off target data available for this crispr