ID: 1058079133

View in Genome Browser
Species Human (GRCh38)
Location 9:100683506-100683528
Sequence GATTTGCAAAGTCTTAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058079133_1058079139 0 Left 1058079133 9:100683506-100683528 CCTACCCTAAGACTTTGCAAATC No data
Right 1058079139 9:100683529-100683551 CACTCCTAGGTATTTCCCCAGGG No data
1058079133_1058079138 -1 Left 1058079133 9:100683506-100683528 CCTACCCTAAGACTTTGCAAATC No data
Right 1058079138 9:100683528-100683550 CCACTCCTAGGTATTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058079133 Original CRISPR GATTTGCAAAGTCTTAGGGT AGG (reversed) Intergenic
No off target data available for this crispr