ID: 1058079135

View in Genome Browser
Species Human (GRCh38)
Location 9:100683511-100683533
Sequence GAGTGGATTTGCAAAGTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058079135_1058079138 -6 Left 1058079135 9:100683511-100683533 CCTAAGACTTTGCAAATCCACTC No data
Right 1058079138 9:100683528-100683550 CCACTCCTAGGTATTTCCCCAGG No data
1058079135_1058079139 -5 Left 1058079135 9:100683511-100683533 CCTAAGACTTTGCAAATCCACTC No data
Right 1058079139 9:100683529-100683551 CACTCCTAGGTATTTCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058079135 Original CRISPR GAGTGGATTTGCAAAGTCTT AGG (reversed) Intergenic
No off target data available for this crispr