ID: 1058079138

View in Genome Browser
Species Human (GRCh38)
Location 9:100683528-100683550
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058079134_1058079138 -5 Left 1058079134 9:100683510-100683532 CCCTAAGACTTTGCAAATCCACT No data
Right 1058079138 9:100683528-100683550 CCACTCCTAGGTATTTCCCCAGG No data
1058079133_1058079138 -1 Left 1058079133 9:100683506-100683528 CCTACCCTAAGACTTTGCAAATC No data
Right 1058079138 9:100683528-100683550 CCACTCCTAGGTATTTCCCCAGG No data
1058079135_1058079138 -6 Left 1058079135 9:100683511-100683533 CCTAAGACTTTGCAAATCCACTC No data
Right 1058079138 9:100683528-100683550 CCACTCCTAGGTATTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058079138 Original CRISPR CCACTCCTAGGTATTTCCCC AGG Intergenic
No off target data available for this crispr