ID: 1058091885

View in Genome Browser
Species Human (GRCh38)
Location 9:100814305-100814327
Sequence GCACCATGGATGGCTGCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058091881_1058091885 -3 Left 1058091881 9:100814285-100814307 CCTTGATGAAAGAAGCCTAGGCA No data
Right 1058091885 9:100814305-100814327 GCACCATGGATGGCTGCTAAAGG No data
1058091877_1058091885 9 Left 1058091877 9:100814273-100814295 CCTGCAGGTGCCCCTTGATGAAA No data
Right 1058091885 9:100814305-100814327 GCACCATGGATGGCTGCTAAAGG No data
1058091880_1058091885 -2 Left 1058091880 9:100814284-100814306 CCCTTGATGAAAGAAGCCTAGGC No data
Right 1058091885 9:100814305-100814327 GCACCATGGATGGCTGCTAAAGG No data
1058091878_1058091885 -1 Left 1058091878 9:100814283-100814305 CCCCTTGATGAAAGAAGCCTAGG No data
Right 1058091885 9:100814305-100814327 GCACCATGGATGGCTGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058091885 Original CRISPR GCACCATGGATGGCTGCTAA AGG Intergenic
No off target data available for this crispr